Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Zbtb20'

728934

Institutional Source

Beutler Lab

Gene Symbol

Zbtb20

Ensembl Gene

ENSMUSG00000022708

Gene Name

zinc finger and BTB domain containing 20

Synonyms

Zfp288, D16Wsu73e, 7330412A13Rik, 1300017A20Rik, HOF, A930017C21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

42875881-43642602 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43609797 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 151 (S151G)

Ref Sequence

ENSEMBL: ENSMUSP00000110339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079441] [ENSMUST00000114690] [ENSMUST00000114691] [ENSMUST00000114694] [ENSMUST00000114695] [ENSMUST00000146708] [ENSMUST00000148775] [ENSMUST00000156367] [ENSMUST00000156981]

AlphaFold

Q8K0L9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079441
AA Change: S224G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000078410
Gene: ENSMUSG00000022708
AA Change: S224G

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114690
AA Change: S151G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110338
Gene: ENSMUSG00000022708
AA Change: S151G

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114691
AA Change: S151G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110339
Gene: ENSMUSG00000022708
AA Change: S151G

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART
low complexity region	330	350	N/A	INTRINSIC
ZnF_C2H2	505	527	6.88e-4	SMART
ZnF_C2H2	533	555	4.17e-3	SMART
ZnF_C2H2	561	583	7.6e-6	SMART
ZnF_C2H2	589	611	5.06e-2	SMART
low complexity region	616	635	N/A	INTRINSIC
ZnF_C2H2	642	664	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114694
AA Change: S224G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110342
Gene: ENSMUSG00000022708
AA Change: S224G

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114695
AA Change: S224G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000110343
Gene: ENSMUSG00000022708
AA Change: S224G

Domain	Start	End	E-Value	Type
BTB	104	197	2.04e-21	SMART
low complexity region	403	423	N/A	INTRINSIC
ZnF_C2H2	578	600	6.88e-4	SMART
ZnF_C2H2	606	628	4.17e-3	SMART
ZnF_C2H2	634	656	7.6e-6	SMART
ZnF_C2H2	662	684	5.06e-2	SMART
low complexity region	689	708	N/A	INTRINSIC
ZnF_C2H2	715	737	7.9e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000146708

SMART Domains

Protein: ENSMUSP00000125233
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	21	74	3.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148775

SMART Domains

Protein: ENSMUSP00000125016
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	21	60	9.8e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156367

SMART Domains

Protein: ENSMUSP00000124126
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
Pfam:BTB	94	131	1.1e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000156981

SMART Domains

Protein: ENSMUSP00000124189
Gene: ENSMUSG00000022708

Domain	Start	End	E-Value	Type
BTB	31	124	2.04e-21	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, which was initially designated as dendritic cell-derived BTB/POZ zinc finger (DPZF), belongs to a family of transcription factors with an N-terminal BTB/POZ domain and a C-terminal DNA-bindng zinc finger domain. The BTB/POZ domain is a hydrophobic region of approximately 120 aa which mediates association with other BTB/POZ domain-containing proteins. This gene acts as a transcriptional repressor and plays a role in many processes including neurogenesis, glucose homeostasis, and postnatal growth. Mutations in this gene have been associated with Primrose syndrome as well as the 3q13.31 microdeletion syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit growth retardation, disrupted homeostasis, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Ehd1	A	G	19: 6,298,300	D436G		Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Zbtb20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Zbtb20	APN	16	43610661	missense	possibly damaging	0.85
IGL02170:Zbtb20	APN	16	43609662	missense	possibly damaging	0.84
IGL02292:Zbtb20	APN	16	43610648	nonsense	probably null
IGL02733:Zbtb20	APN	16	43609933	missense	possibly damaging	0.48
IGL03277:Zbtb20	APN	16	43618437	missense	possibly damaging	0.95
siberian	UTSW	16	43610676	missense	probably damaging	0.96
Tiger	UTSW	16	43618398	missense	probably damaging	0.98
Towering	UTSW	16	43610867	nonsense	probably null
R0310:Zbtb20	UTSW	16	43609746	missense	probably damaging	0.98
R1593:Zbtb20	UTSW	16	43609423	missense	probably damaging	0.99
R1996:Zbtb20	UTSW	16	43610080	missense	probably damaging	0.98
R2018:Zbtb20	UTSW	16	43577652	missense	possibly damaging	0.86
R2050:Zbtb20	UTSW	16	43609612	splice site	probably null
R2097:Zbtb20	UTSW	16	43609519	missense	probably null	1.00
R4006:Zbtb20	UTSW	16	43609399	missense	probably damaging	1.00
R4708:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4710:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R4835:Zbtb20	UTSW	16	43618398	missense	probably damaging	0.98
R4962:Zbtb20	UTSW	16	43618692	missense	probably damaging	0.99
R5531:Zbtb20	UTSW	16	43610867	nonsense	probably null
R7452:Zbtb20	UTSW	16	43610676	missense	probably damaging	0.96
R7523:Zbtb20	UTSW	16	43610512	missense	probably benign	0.01
R8175:Zbtb20	UTSW	16	43577080	intron	probably benign
R8306:Zbtb20	UTSW	16	43618737	missense	probably damaging	0.99
R8811:Zbtb20	UTSW	16	43610494	missense	probably benign
R8922:Zbtb20	UTSW	16	43577605	missense	probably damaging	0.99
R9164:Zbtb20	UTSW	16	43610401	missense	probably benign	0.02
Z1176:Zbtb20	UTSW	16	43610530	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- CTCATTGACTTCATGTACAGCGG -3'
(R):5'- ATCCAGCTAGGGTCTTCCATG -3'

Sequencing Primer
(F):5'- TGCTGAGAGTCTCACAGTCG -3'
(R):5'- CAGCTAGGGTCTTCCATGTGGTG -3'

Posted On

2022-10-06