Incidental Mutation 'R9687:Vmn2r109'
ID 728936
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.062) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 20760779-20785018 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 20775332 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 132 (Q132K)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: Q132K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20,770,419 (GRCm39) missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20,761,383 (GRCm39) missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20,761,671 (GRCm39) missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20,774,654 (GRCm39) missense probably benign
IGL01864:Vmn2r109 APN 17 20,761,396 (GRCm39) missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20,761,342 (GRCm39) missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20,774,603 (GRCm39) missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20,774,422 (GRCm39) missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20,761,150 (GRCm39) missense probably benign
IGL02490:Vmn2r109 APN 17 20,761,246 (GRCm39) missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20,760,963 (GRCm39) missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20,774,518 (GRCm39) missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20,774,062 (GRCm39) missense probably benign
IGL02745:Vmn2r109 APN 17 20,761,512 (GRCm39) missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20,774,839 (GRCm39) critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20,773,148 (GRCm39) missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20,760,937 (GRCm39) missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20,761,670 (GRCm39) nonsense probably null
R0882:Vmn2r109 UTSW 17 20,774,842 (GRCm39) splice site probably benign
R1241:Vmn2r109 UTSW 17 20,775,503 (GRCm39) missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20,761,002 (GRCm39) missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20,774,072 (GRCm39) nonsense probably null
R1957:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20,774,185 (GRCm39) missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20,761,448 (GRCm39) nonsense probably null
R2073:Vmn2r109 UTSW 17 20,784,974 (GRCm39) missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20,774,798 (GRCm39) missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20,761,248 (GRCm39) missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20,774,704 (GRCm39) missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20,774,074 (GRCm39) missense probably benign
R4428:Vmn2r109 UTSW 17 20,773,286 (GRCm39) missense probably benign
R4584:Vmn2r109 UTSW 17 20,774,820 (GRCm39) nonsense probably null
R4652:Vmn2r109 UTSW 17 20,761,656 (GRCm39) missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20,761,605 (GRCm39) missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20,774,153 (GRCm39) missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20,761,494 (GRCm39) missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20,770,348 (GRCm39) missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20,775,451 (GRCm39) missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20,774,603 (GRCm39) missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20,761,189 (GRCm39) missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20,760,933 (GRCm39) missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20,760,781 (GRCm39) makesense probably null
R5702:Vmn2r109 UTSW 17 20,774,407 (GRCm39) missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20,774,567 (GRCm39) missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20,773,121 (GRCm39) missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20,761,318 (GRCm39) missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20,760,981 (GRCm39) missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20,761,440 (GRCm39) missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20,784,796 (GRCm39) critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20,774,785 (GRCm39) missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20,760,932 (GRCm39) missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20,760,973 (GRCm39) missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20,785,006 (GRCm39) missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20,761,225 (GRCm39) missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20,761,336 (GRCm39) missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20,760,945 (GRCm39) missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20,761,700 (GRCm39) missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20,761,043 (GRCm39) missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20,761,536 (GRCm39) missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20,774,665 (GRCm39) missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20,760,942 (GRCm39) missense probably damaging 0.98
R7728:Vmn2r109 UTSW 17 20,773,117 (GRCm39) missense probably damaging 0.99
R7859:Vmn2r109 UTSW 17 20,761,436 (GRCm39) missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20,760,782 (GRCm39) missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20,774,729 (GRCm39) missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20,784,969 (GRCm39) missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20,774,531 (GRCm39) missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20,773,256 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTATTATCAACAAGGGATGTG -3'
(R):5'- TCAACATGTGGTCCAGGCTG -3'

Sequencing Primer
(F):5'- GGATGTGATTCCCAGTTCTGACAC -3'
(R):5'- AACATGTGGTCCAGGCTGTATTTTTC -3'
Posted On 2022-10-06