Incidental Mutation 'R9687:Fbxo11'
ID 728943
Institutional Source Beutler Lab
Gene Symbol Fbxo11
Ensembl Gene ENSMUSG00000005371
Gene Name F-box protein 11
Synonyms GENA 104, Jf
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 88298287-88372719 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 88316494 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 293 (I293T)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005504]
AlphaFold Q7TPD1
Predicted Effect probably benign
Transcript: ENSMUST00000005504
AA Change: I369T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371
AA Change: I369T

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371
AA Change: I293T

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135639
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. It can function as an arginine methyltransferase that symmetrically dimethylates arginine residues, and it acts as an adaptor protein to mediate the neddylation of p53, which leads to the suppression of p53 function. This gene is known to be down-regulated in melanocytes from patients with vitiligo, a skin disorder that results in depigmentation. Polymorphisms in this gene are associated with chronic otitis media with effusion and recurrent otitis media (COME/ROM), a hearing loss disorder, and the knockout of the homologous mouse gene results in the deaf mouse mutant Jeff (Jf), a single gene model of otitis media. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cleft palate, facial clefting, and perinatal lethality. Mice homozygous for a knock-out allele show neonatal lethality, thick epidermis, decreased hair follicle number, absent keratohyalin granules, and increased epidermal Snail protein levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Ehd1 A G 19: 6,348,330 (GRCm39) D436G Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Fbxo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01564:Fbxo11 APN 17 88,310,324 (GRCm39) missense probably benign 0.02
IGL01908:Fbxo11 APN 17 88,299,728 (GRCm39) missense probably benign 0.10
IGL02012:Fbxo11 APN 17 88,320,079 (GRCm39) missense probably benign 0.00
IGL02149:Fbxo11 APN 17 88,301,187 (GRCm39) missense possibly damaging 0.85
IGL02223:Fbxo11 APN 17 88,316,714 (GRCm39) missense probably benign 0.03
IGL02586:Fbxo11 APN 17 88,318,711 (GRCm39) unclassified probably benign
IGL03265:Fbxo11 APN 17 88,300,259 (GRCm39) missense probably damaging 1.00
Gravlachs UTSW 17 88,304,957 (GRCm39) missense
R0184:Fbxo11 UTSW 17 88,316,101 (GRCm39) missense probably benign 0.19
R0335:Fbxo11 UTSW 17 88,323,041 (GRCm39) missense possibly damaging 0.90
R0918:Fbxo11 UTSW 17 88,305,031 (GRCm39) missense probably damaging 1.00
R1658:Fbxo11 UTSW 17 88,320,086 (GRCm39) missense probably benign 0.01
R3725:Fbxo11 UTSW 17 88,316,714 (GRCm39) missense probably benign 0.03
R4194:Fbxo11 UTSW 17 88,316,536 (GRCm39) missense possibly damaging 0.94
R4884:Fbxo11 UTSW 17 88,299,761 (GRCm39) missense probably damaging 0.99
R4902:Fbxo11 UTSW 17 88,372,702 (GRCm39) unclassified probably benign
R5651:Fbxo11 UTSW 17 88,323,136 (GRCm39) missense probably benign 0.01
R6137:Fbxo11 UTSW 17 88,316,097 (GRCm39) missense probably benign 0.00
R6217:Fbxo11 UTSW 17 88,316,332 (GRCm39) missense probably benign 0.00
R6482:Fbxo11 UTSW 17 88,320,086 (GRCm39) missense probably benign 0.01
R7383:Fbxo11 UTSW 17 88,310,282 (GRCm39) missense
R7813:Fbxo11 UTSW 17 88,308,245 (GRCm39) missense
R7823:Fbxo11 UTSW 17 88,300,610 (GRCm39) missense probably damaging 0.98
R7914:Fbxo11 UTSW 17 88,320,031 (GRCm39) missense
R8835:Fbxo11 UTSW 17 88,321,874 (GRCm39) missense
R8882:Fbxo11 UTSW 17 88,304,957 (GRCm39) missense
R8883:Fbxo11 UTSW 17 88,305,044 (GRCm39) missense
R9056:Fbxo11 UTSW 17 88,310,249 (GRCm39) missense
R9223:Fbxo11 UTSW 17 88,323,124 (GRCm39) missense
R9239:Fbxo11 UTSW 17 88,316,522 (GRCm39) missense
R9574:Fbxo11 UTSW 17 88,321,951 (GRCm39) missense
R9616:Fbxo11 UTSW 17 88,316,098 (GRCm39) missense
R9639:Fbxo11 UTSW 17 88,316,107 (GRCm39) missense
RF002:Fbxo11 UTSW 17 88,303,481 (GRCm39) missense
X0060:Fbxo11 UTSW 17 88,299,734 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACAGTCACTGATGTTACAATGC -3'
(R):5'- TCATGGAAGGCTCTGAAGATGC -3'

Sequencing Primer
(F):5'- ATGTTACAATGCTTGATAGTGGGAC -3'
(R):5'- CATGGAAGGCTCTGAAGATGCTTATG -3'
Posted On 2022-10-06