Incidental Mutation 'R9687:Rab18'
ID 728944
Institutional Source Beutler Lab
Gene Symbol Rab18
Ensembl Gene ENSMUSG00000073639
Gene Name RAB18, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.736) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 6765205-6790231 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 6784622 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 104 (N104K)
Ref Sequence ENSEMBL: ENSMUSP00000095285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097680]
AlphaFold P35293
Predicted Effect probably benign
Transcript: ENSMUST00000097680
AA Change: N104K

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095285
Gene: ENSMUSG00000073639
AA Change: N104K

DomainStartEndE-ValueType
RAB 9 172 1.83e-104 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the Ras-related small GTPases, which regulate membrane trafficking in organelles and transport vesicles. This protein is expressed predominantly in lipid droplets, organelles that store neutral lipids, and is proposed to play a role in lipolysis and lipogenesis. In humans mutations in this gene are associated with Warburg micro syndrome type 3. A pseudogene of this gene is located on chromosome X. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice show partial perinatal lethality and abnormal eye development, and develop nuclear cataracts, atonic pupils, progressive limb weakness, disruption of neuronal cytoskeleton, and accumulation of neurofilament and microtubule proteins in synaptic terminals. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,948,422 L446P probably damaging Het
Abcc9 T C 6: 142,633,163 T927A probably benign Het
Abraxas2 A G 7: 132,880,848 T258A probably benign Het
Akna A T 4: 63,374,437 C1078* probably null Het
Arhgap24 T A 5: 102,846,156 F34L probably benign Het
Cpa5 C T 6: 30,614,042 T61I probably benign Het
Crebrf A G 17: 26,763,627 *654W probably null Het
Dchs1 C A 7: 105,757,984 R2134L probably damaging Het
Dcps T C 9: 35,124,682 N303D probably damaging Het
Ddhd1 C T 14: 45,610,733 E527K probably damaging Het
Dnah14 T A 1: 181,598,413 M174K probably benign Het
Ehd1 A G 19: 6,298,300 D436G Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etv1 T C 12: 38,861,362 Y396H probably damaging Het
Fam189a2 A G 19: 23,979,665 I327T probably damaging Het
Fbxo11 A G 17: 88,009,066 I293T Het
Gcfc2 T A 6: 81,941,342 S338T probably damaging Het
Gm10272 T C 10: 77,706,930 V102A possibly damaging Het
Gm11110 T C 17: 57,103,439 T20A unknown Het
Gm17359 G A 3: 79,429,992 D36N possibly damaging Het
Gna14 G A 19: 16,604,986 R206Q Het
Gpm6a T C 8: 55,050,174 Y153H possibly damaging Het
Grip1 G A 10: 120,038,664 E778K possibly damaging Het
H2-M10.6 G A 17: 36,814,255 V313I probably benign Het
Igkv8-19 T C 6: 70,341,021 I74V probably benign Het
Kif24 A G 4: 41,428,546 L138P probably damaging Het
Kif26a A G 12: 112,177,191 E1293G probably damaging Het
Lrp1 A C 10: 127,566,693 L2203R probably damaging Het
Ms4a6b A G 19: 11,520,442 D35G possibly damaging Het
Myo1h A T 5: 114,320,708 D184V Het
Ncdn G A 4: 126,748,674 R397W probably damaging Het
Ncor1 A T 11: 62,369,367 I519N possibly damaging Het
Obsl1 A G 1: 75,503,026 V575A probably damaging Het
Olfr1031 G T 2: 85,991,876 V20L probably benign Het
Olfr1351 T A 10: 79,018,009 I229N probably damaging Het
Olfr1387 T C 11: 49,459,691 F4S probably benign Het
Osbpl5 A G 7: 143,693,861 Y747H possibly damaging Het
Pcdh18 T A 3: 49,756,587 D93V probably damaging Het
Ppef2 T A 5: 92,238,887 D397V probably benign Het
Ppfia4 G A 1: 134,317,956 T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 S178P probably damaging Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Pxk A G 14: 8,151,567 I461V possibly damaging Het
Sars A G 3: 108,435,905 L90P probably benign Het
Scaf8 T A 17: 3,171,135 I299N unknown Het
Sh3bp2 C T 5: 34,559,633 P463S probably benign Het
Slc12a3 A G 8: 94,348,580 N734S possibly damaging Het
Slc12a7 G T 13: 73,790,677 R191L probably damaging Het
Slc7a12 A G 3: 14,480,900 Y35C possibly damaging Het
Susd4 A G 1: 182,895,197 probably null Het
Taar7f G A 10: 24,049,829 R107K probably benign Het
Tarm1 T C 7: 3,495,941 T237A probably benign Het
Tshr C A 12: 91,537,665 A459E probably damaging Het
Tubgcp5 G T 7: 55,825,579 probably null Het
Unc13b T C 4: 43,174,920 V1916A unknown Het
Unc45b A G 11: 82,919,736 D274G probably damaging Het
Vmn1r230 T A 17: 20,847,342 Y264* probably null Het
Vmn2r109 G T 17: 20,555,070 Q132K Het
Zbtb20 A G 16: 43,609,797 S151G possibly damaging Het
Zbtb22 A C 17: 33,917,876 T332P probably damaging Het
Zc3h6 A G 2: 129,017,361 D1104G probably damaging Het
Zfp748 A G 13: 67,542,352 V263A probably benign Het
Zhx3 A C 2: 160,781,758 V163G probably benign Het
Other mutations in Rab18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02793:Rab18 APN 18 6788474 splice site probably benign
R2018:Rab18 UTSW 18 6770113 splice site probably null
R2248:Rab18 UTSW 18 6788629 missense probably damaging 1.00
R2314:Rab18 UTSW 18 6788516 missense probably damaging 1.00
R3976:Rab18 UTSW 18 6778529 missense probably benign 0.00
R6240:Rab18 UTSW 18 6784635 missense probably benign 0.23
R7081:Rab18 UTSW 18 6778529 missense probably benign 0.00
R7652:Rab18 UTSW 18 6783123 missense possibly damaging 0.95
R8696:Rab18 UTSW 18 6788635 missense probably damaging 1.00
R9628:Rab18 UTSW 18 6788647 missense probably benign 0.01
X0026:Rab18 UTSW 18 6788615 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTACTTAGGATTACACAGTGAAGG -3'
(R):5'- CAGCCTGGGCAAGTTAACAAG -3'

Sequencing Primer
(F):5'- CACTAATGTTAGCTTTTAGTGAC -3'
(R):5'- GAACTACCCAAATGTCAAGTATC -3'
Posted On 2022-10-06