Incidental Mutation 'R9687:Ehd1'
ID 728945
Institutional Source Beutler Lab
Gene Symbol Ehd1
Ensembl Gene ENSMUSG00000024772
Gene Name EH-domain containing 1
Synonyms RME-1, Past1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9687 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 6326926-6350126 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6348330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 436 (D436G)
Ref Sequence ENSEMBL: ENSMUSP00000025684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025684]
AlphaFold Q9WVK4
Predicted Effect
SMART Domains Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: D436G

DomainStartEndE-ValueType
Pfam:EHD_N 24 56 1.2e-19 PFAM
Pfam:MMR_HSR1 60 220 5.1e-9 PFAM
Pfam:Dynamin_N 61 221 6.6e-15 PFAM
low complexity region 420 433 N/A INTRINSIC
EH 438 531 1.82e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148547
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171203
Meta Mutation Damage Score 0.2689 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930111J21Rik1 A G 11: 48,839,249 (GRCm39) L446P probably damaging Het
Abcc9 T C 6: 142,578,889 (GRCm39) T927A probably benign Het
Abraxas2 A G 7: 132,482,577 (GRCm39) T258A probably benign Het
Akna A T 4: 63,292,674 (GRCm39) C1078* probably null Het
Arhgap24 T A 5: 102,994,022 (GRCm39) F34L probably benign Het
Cpa5 C T 6: 30,614,041 (GRCm39) T61I probably benign Het
Crebrf A G 17: 26,982,601 (GRCm39) *654W probably null Het
Dchs1 C A 7: 105,407,191 (GRCm39) R2134L probably damaging Het
Dcps T C 9: 35,035,978 (GRCm39) N303D probably damaging Het
Ddhd1 C T 14: 45,848,190 (GRCm39) E527K probably damaging Het
Dnah14 T A 1: 181,425,978 (GRCm39) M174K probably benign Het
Entrep1 A G 19: 23,957,029 (GRCm39) I327T probably damaging Het
Epha8 G T 4: 136,665,897 (GRCm39) L420M probably damaging Het
Etv1 T C 12: 38,911,361 (GRCm39) Y396H probably damaging Het
Fbxo11 A G 17: 88,316,494 (GRCm39) I293T Het
Gcfc2 T A 6: 81,918,323 (GRCm39) S338T probably damaging Het
Gm10272 T C 10: 77,542,764 (GRCm39) V102A possibly damaging Het
Gm11110 T C 17: 57,410,439 (GRCm39) T20A unknown Het
Gna14 G A 19: 16,582,350 (GRCm39) R206Q Het
Gpm6a T C 8: 55,503,209 (GRCm39) Y153H possibly damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
H2-M10.6 G A 17: 37,125,147 (GRCm39) V313I probably benign Het
Igkv8-19 T C 6: 70,318,005 (GRCm39) I74V probably benign Het
Kif24 A G 4: 41,428,546 (GRCm39) L138P probably damaging Het
Kif26a A G 12: 112,143,625 (GRCm39) E1293G probably damaging Het
Lrp1 A C 10: 127,402,562 (GRCm39) L2203R probably damaging Het
Ms4a6b A G 19: 11,497,806 (GRCm39) D35G possibly damaging Het
Myo1h A T 5: 114,458,769 (GRCm39) D184V Het
Ncdn G A 4: 126,642,467 (GRCm39) R397W probably damaging Het
Ncor1 A T 11: 62,260,193 (GRCm39) I519N possibly damaging Het
Obsl1 A G 1: 75,479,670 (GRCm39) V575A probably damaging Het
Or2y15 T C 11: 49,350,518 (GRCm39) F4S probably benign Het
Or5m8 G T 2: 85,822,220 (GRCm39) V20L probably benign Het
Or7a35 T A 10: 78,853,843 (GRCm39) I229N probably damaging Het
Osbpl5 A G 7: 143,247,598 (GRCm39) Y747H possibly damaging Het
Pcdh18 T A 3: 49,711,036 (GRCm39) D93V probably damaging Het
Ppef2 T A 5: 92,386,746 (GRCm39) D397V probably benign Het
Ppfia4 G A 1: 134,245,694 (GRCm39) T620I probably benign Het
Ppp1r9a T C 6: 4,905,978 (GRCm39) S178P probably damaging Het
Ptchd4 A G 17: 42,813,467 (GRCm39) Y456C probably damaging Het
Pxk A G 14: 8,151,567 (GRCm38) I461V possibly damaging Het
Rab18 T A 18: 6,784,622 (GRCm39) N104K probably benign Het
Sars1 A G 3: 108,343,221 (GRCm39) L90P probably benign Het
Scaf8 T A 17: 3,221,410 (GRCm39) I299N unknown Het
Sh3bp2 C T 5: 34,716,977 (GRCm39) P463S probably benign Het
Slc12a3 A G 8: 95,075,208 (GRCm39) N734S possibly damaging Het
Slc12a7 G T 13: 73,938,796 (GRCm39) R191L probably damaging Het
Slc7a12 A G 3: 14,545,960 (GRCm39) Y35C possibly damaging Het
Spmip2 G A 3: 79,337,299 (GRCm39) D36N possibly damaging Het
Susd4 A G 1: 182,722,762 (GRCm39) probably null Het
Taar7f G A 10: 23,925,727 (GRCm39) R107K probably benign Het
Tarm1 T C 7: 3,544,457 (GRCm39) T237A probably benign Het
Tshr C A 12: 91,504,439 (GRCm39) A459E probably damaging Het
Tubgcp5 G T 7: 55,475,327 (GRCm39) probably null Het
Unc13b T C 4: 43,174,920 (GRCm39) V1916A unknown Het
Unc45b A G 11: 82,810,562 (GRCm39) D274G probably damaging Het
Vmn1r230 T A 17: 21,067,604 (GRCm39) Y264* probably null Het
Vmn2r109 G T 17: 20,775,332 (GRCm39) Q132K Het
Zbtb20 A G 16: 43,430,160 (GRCm39) S151G possibly damaging Het
Zbtb22 A C 17: 34,136,850 (GRCm39) T332P probably damaging Het
Zc3h6 A G 2: 128,859,281 (GRCm39) D1104G probably damaging Het
Zfp748 A G 13: 67,690,471 (GRCm39) V263A probably benign Het
Zhx3 A C 2: 160,623,678 (GRCm39) V163G probably benign Het
Other mutations in Ehd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ehd1 APN 19 6,348,177 (GRCm39) missense possibly damaging 0.86
IGL02573:Ehd1 APN 19 6,344,330 (GRCm39) missense probably damaging 1.00
IGL03146:Ehd1 APN 19 6,327,368 (GRCm39) missense probably damaging 1.00
declining UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1376:Ehd1 UTSW 19 6,344,418 (GRCm39) missense probably damaging 1.00
R1593:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R2062:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2064:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2065:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2066:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2067:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2068:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R2217:Ehd1 UTSW 19 6,348,502 (GRCm39) missense probably damaging 1.00
R3436:Ehd1 UTSW 19 6,327,044 (GRCm39) nonsense probably null
R3705:Ehd1 UTSW 19 6,348,330 (GRCm39) missense
R4654:Ehd1 UTSW 19 6,326,994 (GRCm39) utr 5 prime probably benign
R4902:Ehd1 UTSW 19 6,344,273 (GRCm39) missense possibly damaging 0.91
R5001:Ehd1 UTSW 19 6,347,724 (GRCm39) missense probably benign 0.14
R5076:Ehd1 UTSW 19 6,327,251 (GRCm39) missense probably benign 0.02
R6327:Ehd1 UTSW 19 6,348,375 (GRCm39) missense possibly damaging 0.81
R6679:Ehd1 UTSW 19 6,344,474 (GRCm39) missense probably benign 0.01
R7120:Ehd1 UTSW 19 6,347,591 (GRCm39) missense probably benign 0.00
R7183:Ehd1 UTSW 19 6,347,684 (GRCm39) missense probably benign 0.02
R7215:Ehd1 UTSW 19 6,347,672 (GRCm39) missense possibly damaging 0.81
R7853:Ehd1 UTSW 19 6,327,225 (GRCm39) missense probably damaging 0.99
R8467:Ehd1 UTSW 19 6,331,318 (GRCm39) missense probably benign 0.24
R8523:Ehd1 UTSW 19 6,344,613 (GRCm39) missense probably damaging 0.98
R8879:Ehd1 UTSW 19 6,348,354 (GRCm39) missense probably damaging 0.97
R8957:Ehd1 UTSW 19 6,344,439 (GRCm39) missense probably damaging 1.00
R9011:Ehd1 UTSW 19 6,348,108 (GRCm39) missense probably benign 0.11
R9664:Ehd1 UTSW 19 6,331,262 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCAAGTTCCAGGCCTTGAAG -3'
(R):5'- GCAAACTCCTCGTCATCCAG -3'

Sequencing Primer
(F):5'- GCCCAAGCTGCTGGATAC -3'
(R):5'- ATCCAGCAGGCCATCCTTG -3'
Posted On 2022-10-06