Mutagenetix > Incidental Mutation

Incidental Mutation 'R9687:Ehd1'

728945

Institutional Source

Beutler Lab

Gene Symbol

Ehd1

Ensembl Gene

ENSMUSG00000024772

Gene Name

EH-domain containing 1

Synonyms

RME-1, Past1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9687 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

6276725-6300096 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6298300 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 436 (D436G)

Ref Sequence

ENSEMBL: ENSMUSP00000025684 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025684]

AlphaFold

Q9WVK4

Predicted Effect

SMART Domains

Protein: ENSMUSP00000025684
Gene: ENSMUSG00000024772
AA Change: D436G

Domain	Start	End	E-Value	Type
Pfam:EHD_N	24	56	1.2e-19	PFAM
Pfam:MMR_HSR1	60	220	5.1e-9	PFAM
Pfam:Dynamin_N	61	221	6.6e-15	PFAM
low complexity region	420	433	N/A	INTRINSIC
EH	438	531	1.82e-45	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148547

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171203

Meta Mutation Damage Score

0.2689

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a highly conserved gene family encoding EPS15 homology (EH) domain-containing proteins. The protein-binding EH domain was first noted in EPS15, a substrate for the epidermal growth factor receptor. The EH domain has been shown to be an important motif in proteins involved in protein-protein interactions and in intracellular sorting. The protein encoded by this gene is thought to play a role in the endocytosis of IGF1 receptors. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show perinatal and postnatal lethality, decreased body weight, and male infertility due to defective spermatogenesis; female homozygotes may display malocclusion and variable ocular defects, including congenital central cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930111J21Rik1	A	G	11: 48,948,422	L446P	probably damaging	Het
Abcc9	T	C	6: 142,633,163	T927A	probably benign	Het
Abraxas2	A	G	7: 132,880,848	T258A	probably benign	Het
Akna	A	T	4: 63,374,437	C1078*	probably null	Het
Arhgap24	T	A	5: 102,846,156	F34L	probably benign	Het
Cpa5	C	T	6: 30,614,042	T61I	probably benign	Het
Crebrf	A	G	17: 26,763,627	*654W	probably null	Het
Dchs1	C	A	7: 105,757,984	R2134L	probably damaging	Het
Dcps	T	C	9: 35,124,682	N303D	probably damaging	Het
Ddhd1	C	T	14: 45,610,733	E527K	probably damaging	Het
Dnah14	T	A	1: 181,598,413	M174K	probably benign	Het
Epha8	G	T	4: 136,938,586	L420M	probably damaging	Het
Etv1	T	C	12: 38,861,362	Y396H	probably damaging	Het
Fam189a2	A	G	19: 23,979,665	I327T	probably damaging	Het
Fbxo11	A	G	17: 88,009,066	I293T		Het
Gcfc2	T	A	6: 81,941,342	S338T	probably damaging	Het
Gm10272	T	C	10: 77,706,930	V102A	possibly damaging	Het
Gm11110	T	C	17: 57,103,439	T20A	unknown	Het
Gm17359	G	A	3: 79,429,992	D36N	possibly damaging	Het
Gna14	G	A	19: 16,604,986	R206Q		Het
Gpm6a	T	C	8: 55,050,174	Y153H	possibly damaging	Het
Grip1	G	A	10: 120,038,664	E778K	possibly damaging	Het
H2-M10.6	G	A	17: 36,814,255	V313I	probably benign	Het
Igkv8-19	T	C	6: 70,341,021	I74V	probably benign	Het
Kif24	A	G	4: 41,428,546	L138P	probably damaging	Het
Kif26a	A	G	12: 112,177,191	E1293G	probably damaging	Het
Lrp1	A	C	10: 127,566,693	L2203R	probably damaging	Het
Ms4a6b	A	G	19: 11,520,442	D35G	possibly damaging	Het
Myo1h	A	T	5: 114,320,708	D184V		Het
Ncdn	G	A	4: 126,748,674	R397W	probably damaging	Het
Ncor1	A	T	11: 62,369,367	I519N	possibly damaging	Het
Obsl1	A	G	1: 75,503,026	V575A	probably damaging	Het
Olfr1031	G	T	2: 85,991,876	V20L	probably benign	Het
Olfr1351	T	A	10: 79,018,009	I229N	probably damaging	Het
Olfr1387	T	C	11: 49,459,691	F4S	probably benign	Het
Osbpl5	A	G	7: 143,693,861	Y747H	possibly damaging	Het
Pcdh18	T	A	3: 49,756,587	D93V	probably damaging	Het
Ppef2	T	A	5: 92,238,887	D397V	probably benign	Het
Ppfia4	G	A	1: 134,317,956	T620I	probably benign	Het
Ppp1r9a	T	C	6: 4,905,978	S178P	probably damaging	Het
Ptchd4	A	G	17: 42,502,576	Y456C	probably damaging	Het
Pxk	A	G	14: 8,151,567	I461V	possibly damaging	Het
Rab18	T	A	18: 6,784,622	N104K	probably benign	Het
Sars	A	G	3: 108,435,905	L90P	probably benign	Het
Scaf8	T	A	17: 3,171,135	I299N	unknown	Het
Sh3bp2	C	T	5: 34,559,633	P463S	probably benign	Het
Slc12a3	A	G	8: 94,348,580	N734S	possibly damaging	Het
Slc12a7	G	T	13: 73,790,677	R191L	probably damaging	Het
Slc7a12	A	G	3: 14,480,900	Y35C	possibly damaging	Het
Susd4	A	G	1: 182,895,197		probably null	Het
Taar7f	G	A	10: 24,049,829	R107K	probably benign	Het
Tarm1	T	C	7: 3,495,941	T237A	probably benign	Het
Tshr	C	A	12: 91,537,665	A459E	probably damaging	Het
Tubgcp5	G	T	7: 55,825,579		probably null	Het
Unc13b	T	C	4: 43,174,920	V1916A	unknown	Het
Unc45b	A	G	11: 82,919,736	D274G	probably damaging	Het
Vmn1r230	T	A	17: 20,847,342	Y264*	probably null	Het
Vmn2r109	G	T	17: 20,555,070	Q132K		Het
Zbtb20	A	G	16: 43,609,797	S151G	possibly damaging	Het
Zbtb22	A	C	17: 33,917,876	T332P	probably damaging	Het
Zc3h6	A	G	2: 129,017,361	D1104G	probably damaging	Het
Zfp748	A	G	13: 67,542,352	V263A	probably benign	Het
Zhx3	A	C	2: 160,781,758	V163G	probably benign	Het

Other mutations in Ehd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01109:Ehd1	APN	19	6298147	missense	possibly damaging	0.86
IGL02573:Ehd1	APN	19	6294300	missense	probably damaging	1.00
IGL03146:Ehd1	APN	19	6277338	missense	probably damaging	1.00
declining	UTSW	19	6294388	missense	probably damaging	1.00
R1376:Ehd1	UTSW	19	6294388	missense	probably damaging	1.00
R1376:Ehd1	UTSW	19	6294388	missense	probably damaging	1.00
R1593:Ehd1	UTSW	19	6298300	missense
R2062:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2064:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2065:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2066:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2067:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2068:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R2217:Ehd1	UTSW	19	6298472	missense	probably damaging	1.00
R3436:Ehd1	UTSW	19	6277014	nonsense	probably null
R3705:Ehd1	UTSW	19	6298300	missense
R4654:Ehd1	UTSW	19	6276964	utr 5 prime	probably benign
R4902:Ehd1	UTSW	19	6294243	missense	possibly damaging	0.91
R5001:Ehd1	UTSW	19	6297694	missense	probably benign	0.14
R5076:Ehd1	UTSW	19	6277221	missense	probably benign	0.02
R6327:Ehd1	UTSW	19	6298345	missense	possibly damaging	0.81
R6679:Ehd1	UTSW	19	6294444	missense	probably benign	0.01
R7120:Ehd1	UTSW	19	6297561	missense	probably benign	0.00
R7183:Ehd1	UTSW	19	6297654	missense	probably benign	0.02
R7215:Ehd1	UTSW	19	6297642	missense	possibly damaging	0.81
R7853:Ehd1	UTSW	19	6277195	missense	probably damaging	0.99
R8467:Ehd1	UTSW	19	6281288	missense	probably benign	0.24
R8523:Ehd1	UTSW	19	6294583	missense	probably damaging	0.98
R8879:Ehd1	UTSW	19	6298324	missense	probably damaging	0.97
R8957:Ehd1	UTSW	19	6294409	missense	probably damaging	1.00
R9011:Ehd1	UTSW	19	6298078	missense	probably benign	0.11
R9664:Ehd1	UTSW	19	6281232	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AGCAAGTTCCAGGCCTTGAAG -3'
(R):5'- GCAAACTCCTCGTCATCCAG -3'

Sequencing Primer
(F):5'- GCCCAAGCTGCTGGATAC -3'
(R):5'- ATCCAGCAGGCCATCCTTG -3'

Posted On

2022-10-06