Incidental Mutation 'R9688:Depdc5'
ID 728967
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9688 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 32863701-32994236 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 32897932 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 226 (Y226*)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect probably null
Transcript: ENSMUST00000049780
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087897
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118698
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119705
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120902
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,519,067 probably null Het
Abca2 G C 2: 25,434,447 A272P possibly damaging Het
Adarb1 T A 10: 77,311,265 D479V probably damaging Het
Amz2 T C 11: 109,429,939 F162S probably damaging Het
Ano4 A T 10: 89,344,644 M1K probably null Het
Antxr1 G A 6: 87,137,352 R478C probably damaging Het
Apobr T C 7: 126,587,491 S725P probably benign Het
Arap2 A T 5: 62,714,766 D506E probably damaging Het
Ash1l T G 3: 88,984,717 I1301S probably damaging Het
Camk1g T A 1: 193,348,721 R305W probably damaging Het
Ces2g A T 8: 104,964,672 I147F probably benign Het
Cfap61 T C 2: 146,036,838 F505L probably damaging Het
Cndp1 G C 18: 84,637,857 N62K probably benign Het
Cog6 G T 3: 53,009,107 Q214K probably benign Het
Elp5 T A 11: 69,970,599 I185F probably damaging Het
Ercc6 A C 14: 32,575,798 H1334P probably benign Het
Ern1 T C 11: 106,459,010 T27A possibly damaging Het
Esf1 A T 2: 140,168,175 D80E probably damaging Het
Evpl T C 11: 116,234,160 K159E probably damaging Het
Gbx1 T C 5: 24,526,512 Y102C probably damaging Het
Gjd2 A G 2: 114,011,628 S123P probably benign Het
H2-M11 A G 17: 36,548,162 Y198C probably damaging Het
Hps1 A C 19: 42,766,708 V265G probably benign Het
Ifna16 C A 4: 88,676,637 E74* probably null Het
Inca1 C T 11: 70,688,984 probably null Het
Jag2 A G 12: 112,908,944 V1230A probably benign Het
Jam3 G A 9: 27,098,908 T260M probably benign Het
Klhl5 A T 5: 65,164,587 D652V probably damaging Het
L3mbtl1 A T 2: 162,948,777 I81L possibly damaging Het
Lgalsl C T 11: 20,829,442 A68T probably benign Het
Map3k14 T A 11: 103,239,233 D286V possibly damaging Het
Mdn1 A G 4: 32,745,590 I4083V probably damaging Het
Ms4a5 T C 19: 11,276,694 I136M possibly damaging Het
Naa16 A T 14: 79,335,869 Y820* probably null Het
Nbea G T 3: 55,649,744 N2537K probably benign Het
Ncapd3 A G 9: 27,056,053 S562G probably benign Het
Olfr1093 A C 2: 86,786,661 K310N probably damaging Het
Olfr786 C A 10: 129,437,098 C95* probably null Het
Papd7 A G 13: 69,507,080 L425P probably damaging Het
Pcdhac2 A G 18: 37,144,575 S203G probably benign Het
Pds5a A T 5: 65,654,853 F309I probably benign Het
Pdzd8 G A 19: 59,345,251 L113F probably benign Het
Pex12 T C 11: 83,298,431 Y4C possibly damaging Het
Ppfibp2 A G 7: 107,719,241 D332G probably benign Het
Psg23 A T 7: 18,610,622 W303R probably damaging Het
Pyy T A 11: 102,107,273 D27V probably damaging Het
Rc3h1 A G 1: 160,942,664 Q302R probably damaging Het
Rhoh A G 5: 65,892,313 probably benign Het
Samd9l A G 6: 3,377,087 M58T probably damaging Het
Scaf11 A C 15: 96,415,927 H1324Q probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Setx A T 2: 29,146,316 S938C probably damaging Het
Sgo2a A T 1: 58,017,578 T974S probably damaging Het
Sh3rf1 T C 8: 61,226,314 V130A probably benign Het
Slc43a2 T C 11: 75,543,286 F97L probably damaging Het
Slc9a9 C A 9: 95,229,054 Q642K probably benign Het
Soga3 T C 10: 29,196,695 V661A possibly damaging Het
Sox6 G T 7: 115,476,990 D804E probably benign Het
Tbx15 A T 3: 99,326,392 R290S possibly damaging Het
Terf2 A G 8: 107,094,911 S176P probably damaging Het
Ttc6 A T 12: 57,673,816 H956L possibly damaging Het
Tti2 T C 8: 31,154,251 V292A probably damaging Het
Vmn1r29 A T 6: 58,307,754 E153V probably benign Het
Vmn1r55 G T 7: 5,146,670 H251Q probably benign Het
Yeats4 T C 10: 117,215,681 T224A probably benign Het
Yipf4 T A 17: 74,499,083 F239Y probably benign Het
Zan T C 5: 137,468,455 D380G probably damaging Het
Zbtb9 T C 17: 26,974,920 F433S probably damaging Het
Zic5 T C 14: 122,464,023 K432R unknown Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 32967814 splice site probably null
IGL01019:Depdc5 APN 5 32893401 missense probably damaging 0.96
IGL01067:Depdc5 APN 5 32899067 splice site probably null
IGL01405:Depdc5 APN 5 32937689 missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 32955897 missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 32924200 missense probably damaging 1.00
IGL01998:Depdc5 APN 5 32945151 splice site probably benign
IGL02025:Depdc5 APN 5 32946632 critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 32903801 missense probably damaging 1.00
IGL02537:Depdc5 APN 5 32967787 missense probably damaging 1.00
IGL02812:Depdc5 APN 5 32893368 splice site probably benign
IGL03001:Depdc5 APN 5 32945090 missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 32868813 unclassified probably benign
alligator UTSW 5 32964507 splice site probably null
lagarto UTSW 5 32979508 missense probably damaging 1.00
sauros UTSW 5 32986966 missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 32956167 splice site probably null
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0038:Depdc5 UTSW 5 32868853 missense probably benign 0.01
R0153:Depdc5 UTSW 5 32933937 splice site probably benign
R0179:Depdc5 UTSW 5 32901574 unclassified probably benign
R0212:Depdc5 UTSW 5 32912242 missense probably benign 0.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0239:Depdc5 UTSW 5 32943240 missense probably damaging 1.00
R0302:Depdc5 UTSW 5 32904546 critical splice donor site probably benign
R0511:Depdc5 UTSW 5 32945028 nonsense probably null
R0677:Depdc5 UTSW 5 32901470 missense probably damaging 1.00
R0884:Depdc5 UTSW 5 32917978 missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 32986966 missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 32877074 missense probably damaging 1.00
R1611:Depdc5 UTSW 5 32990953 missense probably damaging 1.00
R1687:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 32917942 missense probably benign 0.24
R1903:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 32903831 missense probably damaging 1.00
R1997:Depdc5 UTSW 5 32901906 critical splice donor site probably null
R2079:Depdc5 UTSW 5 32946674 missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 32990781 nonsense probably null
R2291:Depdc5 UTSW 5 32979402 missense probably damaging 1.00
R2422:Depdc5 UTSW 5 32991035 missense probably damaging 1.00
R2851:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2852:Depdc5 UTSW 5 32924171 missense probably damaging 0.96
R2937:Depdc5 UTSW 5 32901621 splice site probably null
R2938:Depdc5 UTSW 5 32901621 splice site probably null
R2974:Depdc5 UTSW 5 32934017 critical splice donor site probably null
R3884:Depdc5 UTSW 5 32944077 missense probably damaging 1.00
R3967:Depdc5 UTSW 5 32944115 nonsense probably null
R4118:Depdc5 UTSW 5 32964635 missense probably damaging 1.00
R4197:Depdc5 UTSW 5 32991203 missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 32904534 critical splice donor site probably null
R4534:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 32910407 critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 32983946 missense probably damaging 1.00
R4613:Depdc5 UTSW 5 32975446 missense probably damaging 1.00
R4736:Depdc5 UTSW 5 32975322 missense probably benign
R4738:Depdc5 UTSW 5 32975322 missense probably benign
R4765:Depdc5 UTSW 5 32937635 missense probably damaging 1.00
R5021:Depdc5 UTSW 5 32979414 missense probably damaging 1.00
R5259:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5261:Depdc5 UTSW 5 32938291 missense probably damaging 1.00
R5541:Depdc5 UTSW 5 32864629 utr 5 prime probably benign
R5594:Depdc5 UTSW 5 32901490 missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 32975506 nonsense probably null
R6132:Depdc5 UTSW 5 32910467 missense probably damaging 0.99
R6146:Depdc5 UTSW 5 32968731 missense probably benign 0.01
R6336:Depdc5 UTSW 5 32964507 splice site probably null
R6468:Depdc5 UTSW 5 32912231 missense probably benign 0.02
R6911:Depdc5 UTSW 5 32924192 missense probably damaging 1.00
R6969:Depdc5 UTSW 5 32983860 missense probably damaging 1.00
R7002:Depdc5 UTSW 5 32877158 splice site probably null
R7066:Depdc5 UTSW 5 32901848 missense probably benign 0.08
R7231:Depdc5 UTSW 5 32901865 missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 32967745 missense probably benign
R7302:Depdc5 UTSW 5 32979508 missense probably damaging 1.00
R7386:Depdc5 UTSW 5 32927936 missense probably benign
R7564:Depdc5 UTSW 5 32901510 missense probably damaging 1.00
R7636:Depdc5 UTSW 5 32917983 missense probably benign
R7795:Depdc5 UTSW 5 32944103 missense probably damaging 1.00
R7845:Depdc5 UTSW 5 32903915 splice site probably null
R8013:Depdc5 UTSW 5 32973842 missense probably benign 0.01
R8037:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8038:Depdc5 UTSW 5 32959348 critical splice donor site probably null
R8065:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 32895908 missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 32945049 missense probably benign 0.01
R8112:Depdc5 UTSW 5 32968706 missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 32937637 missense probably damaging 1.00
R8382:Depdc5 UTSW 5 32927898 missense probably benign 0.00
R8680:Depdc5 UTSW 5 32944038 missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 32924243 missense probably benign 0.10
R8754:Depdc5 UTSW 5 32979537 missense probably benign 0.00
R9157:Depdc5 UTSW 5 32945108 missense probably damaging 0.98
R9364:Depdc5 UTSW 5 32964732 missense probably benign
R9441:Depdc5 UTSW 5 32937698 missense probably benign 0.03
R9450:Depdc5 UTSW 5 32934010 missense probably benign
R9459:Depdc5 UTSW 5 32990773 missense probably damaging 0.99
R9554:Depdc5 UTSW 5 32964732 missense probably benign
R9569:Depdc5 UTSW 5 32867977 missense probably damaging 0.98
R9647:Depdc5 UTSW 5 32924223 missense possibly damaging 0.94
X0027:Depdc5 UTSW 5 32904292 missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 32943282 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCAAGCATTTTCACATCCTTGG -3'
(R):5'- ACAGACAGATAAAATTTGGACTGTG -3'

Sequencing Primer
(F):5'- TACAGCAGGTCTTCTGACAGCATG -3'
(R):5'- AGAGTACTGACTGCTCTTCCAGAG -3'
Posted On 2022-10-06