Incidental Mutation 'R9688:Depdc5'
ID 728967
Institutional Source Beutler Lab
Gene Symbol Depdc5
Ensembl Gene ENSMUSG00000037426
Gene Name DEP domain containing 5
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9688 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 33021045-33151580 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 33055276 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 226 (Y226*)
Ref Sequence ENSEMBL: ENSMUSP00000113862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049780] [ENSMUST00000087897] [ENSMUST00000118698] [ENSMUST00000119705] [ENSMUST00000120902] [ENSMUST00000195980]
AlphaFold P61460
Predicted Effect probably null
Transcript: ENSMUST00000049780
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000052807
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-64 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000087897
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000085207
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 2.3e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 826 836 N/A INTRINSIC
low complexity region 994 1006 N/A INTRINSIC
low complexity region 1159 1175 N/A INTRINSIC
DEP 1184 1259 2.49e-15 SMART
low complexity region 1322 1335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118698
SMART Domains Protein: ENSMUSP00000112906
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 205 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119705
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000113862
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3e-117 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1150 1166 N/A INTRINSIC
DEP 1175 1250 2.49e-15 SMART
low complexity region 1313 1326 N/A INTRINSIC
low complexity region 1511 1525 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120902
AA Change: Y226*
SMART Domains Protein: ENSMUSP00000113980
Gene: ENSMUSG00000037426
AA Change: Y226*

DomainStartEndE-ValueType
Pfam:DUF3608 100 382 3.7e-63 PFAM
low complexity region 491 508 N/A INTRINSIC
low complexity region 656 667 N/A INTRINSIC
low complexity region 690 699 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1128 1144 N/A INTRINSIC
DEP 1153 1228 2.49e-15 SMART
low complexity region 1291 1304 N/A INTRINSIC
low complexity region 1489 1503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195980
SMART Domains Protein: ENSMUSP00000143228
Gene: ENSMUSG00000037426

DomainStartEndE-ValueType
Pfam:DUF3608 100 147 4e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IML1 family of proteins involved in G-protein signaling pathways. The mechanistic target of rapamycin complex 1 (mTORC1) pathway regulates cell growth by sensing the availability of nutrients. The protein encoded by this gene is a component of the GATOR1 (GAP activity toward Rags) complex which inhibits the amino acid-sensing branch of the mTORC1 pathway. Mutations in this gene are associated with autosomal dominant familial focal epilepsy with variable foci. A single nucleotide polymorphism in an intron of this gene has been associated with an increased risk of hepatocellular carcinoma in individuals with chronic hepatitis C virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for a conditional allele activated in neurons exhibit reduced body weight, limb grasping, premature death, spontaneous seizure, increased brain size due to neuron hypertrophy and increased PTZ seizure susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik A G 11: 23,469,067 (GRCm39) probably null Het
Abca2 G C 2: 25,324,459 (GRCm39) A272P possibly damaging Het
Adarb1 T A 10: 77,147,099 (GRCm39) D479V probably damaging Het
Amz2 T C 11: 109,320,765 (GRCm39) F162S probably damaging Het
Ano4 A T 10: 89,180,506 (GRCm39) M1K probably null Het
Antxr1 G A 6: 87,114,334 (GRCm39) R478C probably damaging Het
Apobr T C 7: 126,186,663 (GRCm39) S725P probably benign Het
Arap2 A T 5: 62,872,109 (GRCm39) D506E probably damaging Het
Ash1l T G 3: 88,892,024 (GRCm39) I1301S probably damaging Het
Camk1g T A 1: 193,031,029 (GRCm39) R305W probably damaging Het
Ces2g A T 8: 105,691,304 (GRCm39) I147F probably benign Het
Cfap61 T C 2: 145,878,758 (GRCm39) F505L probably damaging Het
Cndp1 G C 18: 84,655,982 (GRCm39) N62K probably benign Het
Cog6 G T 3: 52,916,528 (GRCm39) Q214K probably benign Het
Elp5 T A 11: 69,861,425 (GRCm39) I185F probably damaging Het
Ercc6 A C 14: 32,297,755 (GRCm39) H1334P probably benign Het
Ern1 T C 11: 106,349,836 (GRCm39) T27A possibly damaging Het
Esf1 A T 2: 140,010,095 (GRCm39) D80E probably damaging Het
Evpl T C 11: 116,124,986 (GRCm39) K159E probably damaging Het
Gbx1 T C 5: 24,731,510 (GRCm39) Y102C probably damaging Het
Gjd2 A G 2: 113,842,109 (GRCm39) S123P probably benign Het
H2-M11 A G 17: 36,859,054 (GRCm39) Y198C probably damaging Het
Hps1 A C 19: 42,755,147 (GRCm39) V265G probably benign Het
Ifna16 C A 4: 88,594,874 (GRCm39) E74* probably null Het
Inca1 C T 11: 70,579,810 (GRCm39) probably null Het
Jag2 A G 12: 112,872,564 (GRCm39) V1230A probably benign Het
Jam3 G A 9: 27,010,204 (GRCm39) T260M probably benign Het
Klhl5 A T 5: 65,321,930 (GRCm39) D652V probably damaging Het
L3mbtl1 A T 2: 162,790,697 (GRCm39) I81L possibly damaging Het
Lgalsl C T 11: 20,779,442 (GRCm39) A68T probably benign Het
Map3k14 T A 11: 103,130,059 (GRCm39) D286V possibly damaging Het
Mdn1 A G 4: 32,745,590 (GRCm39) I4083V probably damaging Het
Ms4a5 T C 19: 11,254,058 (GRCm39) I136M possibly damaging Het
Mtcl3 T C 10: 29,072,691 (GRCm39) V661A possibly damaging Het
Naa16 A T 14: 79,573,309 (GRCm39) Y820* probably null Het
Nbea G T 3: 55,557,165 (GRCm39) N2537K probably benign Het
Ncapd3 A G 9: 26,967,349 (GRCm39) S562G probably benign Het
Or5t5 A C 2: 86,617,005 (GRCm39) K310N probably damaging Het
Or6c1b C A 10: 129,272,967 (GRCm39) C95* probably null Het
Pcdhac2 A G 18: 37,277,628 (GRCm39) S203G probably benign Het
Pds5a A T 5: 65,812,196 (GRCm39) F309I probably benign Het
Pdzd8 G A 19: 59,333,683 (GRCm39) L113F probably benign Het
Pex12 T C 11: 83,189,257 (GRCm39) Y4C possibly damaging Het
Ppfibp2 A G 7: 107,318,448 (GRCm39) D332G probably benign Het
Psg23 A T 7: 18,344,547 (GRCm39) W303R probably damaging Het
Pyy T A 11: 101,998,099 (GRCm39) D27V probably damaging Het
Rc3h1 A G 1: 160,770,234 (GRCm39) Q302R probably damaging Het
Rhoh A G 5: 66,049,656 (GRCm39) probably benign Het
Samd9l A G 6: 3,377,087 (GRCm39) M58T probably damaging Het
Scaf11 A C 15: 96,313,808 (GRCm39) H1324Q probably damaging Het
Serinc2 C A 4: 130,158,133 (GRCm39) A105S probably damaging Het
Setx A T 2: 29,036,328 (GRCm39) S938C probably damaging Het
Sgo2a A T 1: 58,056,737 (GRCm39) T974S probably damaging Het
Sh3rf1 T C 8: 61,679,348 (GRCm39) V130A probably benign Het
Slc43a2 T C 11: 75,434,112 (GRCm39) F97L probably damaging Het
Slc9a9 C A 9: 95,111,107 (GRCm39) Q642K probably benign Het
Sox6 G T 7: 115,076,225 (GRCm39) D804E probably benign Het
Tbx15 A T 3: 99,233,708 (GRCm39) R290S possibly damaging Het
Tent4a A G 13: 69,655,199 (GRCm39) L425P probably damaging Het
Terf2 A G 8: 107,821,543 (GRCm39) S176P probably damaging Het
Ttc6 A T 12: 57,720,602 (GRCm39) H956L possibly damaging Het
Tti2 T C 8: 31,644,279 (GRCm39) V292A probably damaging Het
Vmn1r29 A T 6: 58,284,739 (GRCm39) E153V probably benign Het
Vmn1r55 G T 7: 5,149,669 (GRCm39) H251Q probably benign Het
Yeats4 T C 10: 117,051,586 (GRCm39) T224A probably benign Het
Yipf4 T A 17: 74,806,078 (GRCm39) F239Y probably benign Het
Zan T C 5: 137,466,717 (GRCm39) D380G probably damaging Het
Zbtb9 T C 17: 27,193,894 (GRCm39) F433S probably damaging Het
Zic5 T C 14: 122,701,435 (GRCm39) K432R unknown Het
Other mutations in Depdc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Depdc5 APN 5 33,125,158 (GRCm39) splice site probably null
IGL01019:Depdc5 APN 5 33,050,745 (GRCm39) missense probably damaging 0.96
IGL01067:Depdc5 APN 5 33,056,411 (GRCm39) splice site probably null
IGL01405:Depdc5 APN 5 33,095,033 (GRCm39) missense possibly damaging 0.90
IGL01577:Depdc5 APN 5 33,113,241 (GRCm39) missense possibly damaging 0.49
IGL01633:Depdc5 APN 5 33,081,544 (GRCm39) missense probably damaging 1.00
IGL01998:Depdc5 APN 5 33,102,495 (GRCm39) splice site probably benign
IGL02025:Depdc5 APN 5 33,103,976 (GRCm39) critical splice acceptor site probably null
IGL02167:Depdc5 APN 5 33,061,145 (GRCm39) missense probably damaging 1.00
IGL02537:Depdc5 APN 5 33,125,131 (GRCm39) missense probably damaging 1.00
IGL02812:Depdc5 APN 5 33,050,712 (GRCm39) splice site probably benign
IGL03001:Depdc5 APN 5 33,102,434 (GRCm39) missense possibly damaging 0.74
IGL03253:Depdc5 APN 5 33,026,157 (GRCm39) unclassified probably benign
alligator UTSW 5 33,121,851 (GRCm39) splice site probably null
lagarto UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
sauros UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
IGL02988:Depdc5 UTSW 5 33,113,511 (GRCm39) splice site probably null
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0038:Depdc5 UTSW 5 33,026,197 (GRCm39) missense probably benign 0.01
R0153:Depdc5 UTSW 5 33,091,281 (GRCm39) splice site probably benign
R0179:Depdc5 UTSW 5 33,058,918 (GRCm39) unclassified probably benign
R0212:Depdc5 UTSW 5 33,069,586 (GRCm39) missense probably benign 0.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0239:Depdc5 UTSW 5 33,100,584 (GRCm39) missense probably damaging 1.00
R0302:Depdc5 UTSW 5 33,061,890 (GRCm39) critical splice donor site probably benign
R0511:Depdc5 UTSW 5 33,102,372 (GRCm39) nonsense probably null
R0677:Depdc5 UTSW 5 33,058,814 (GRCm39) missense probably damaging 1.00
R0884:Depdc5 UTSW 5 33,075,322 (GRCm39) missense possibly damaging 0.94
R0973:Depdc5 UTSW 5 33,144,310 (GRCm39) missense possibly damaging 0.92
R1314:Depdc5 UTSW 5 33,034,418 (GRCm39) missense probably damaging 1.00
R1611:Depdc5 UTSW 5 33,148,297 (GRCm39) missense probably damaging 1.00
R1687:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1748:Depdc5 UTSW 5 33,075,286 (GRCm39) missense probably benign 0.24
R1903:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R1956:Depdc5 UTSW 5 33,061,175 (GRCm39) missense probably damaging 1.00
R1997:Depdc5 UTSW 5 33,059,250 (GRCm39) critical splice donor site probably null
R2079:Depdc5 UTSW 5 33,104,018 (GRCm39) missense possibly damaging 0.75
R2131:Depdc5 UTSW 5 33,148,125 (GRCm39) nonsense probably null
R2291:Depdc5 UTSW 5 33,136,746 (GRCm39) missense probably damaging 1.00
R2422:Depdc5 UTSW 5 33,148,379 (GRCm39) missense probably damaging 1.00
R2851:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2852:Depdc5 UTSW 5 33,081,515 (GRCm39) missense probably damaging 0.96
R2937:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2938:Depdc5 UTSW 5 33,058,965 (GRCm39) splice site probably null
R2974:Depdc5 UTSW 5 33,091,361 (GRCm39) critical splice donor site probably null
R3884:Depdc5 UTSW 5 33,101,421 (GRCm39) missense probably damaging 1.00
R3967:Depdc5 UTSW 5 33,101,459 (GRCm39) nonsense probably null
R4118:Depdc5 UTSW 5 33,121,979 (GRCm39) missense probably damaging 1.00
R4197:Depdc5 UTSW 5 33,148,547 (GRCm39) missense possibly damaging 0.93
R4407:Depdc5 UTSW 5 33,061,878 (GRCm39) critical splice donor site probably null
R4534:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4535:Depdc5 UTSW 5 33,067,751 (GRCm39) critical splice acceptor site probably benign
R4538:Depdc5 UTSW 5 33,141,290 (GRCm39) missense probably damaging 1.00
R4613:Depdc5 UTSW 5 33,132,790 (GRCm39) missense probably damaging 1.00
R4736:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4738:Depdc5 UTSW 5 33,132,666 (GRCm39) missense probably benign
R4765:Depdc5 UTSW 5 33,094,979 (GRCm39) missense probably damaging 1.00
R5021:Depdc5 UTSW 5 33,136,758 (GRCm39) missense probably damaging 1.00
R5259:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5261:Depdc5 UTSW 5 33,095,635 (GRCm39) missense probably damaging 1.00
R5541:Depdc5 UTSW 5 33,021,973 (GRCm39) utr 5 prime probably benign
R5594:Depdc5 UTSW 5 33,058,834 (GRCm39) missense possibly damaging 0.46
R5929:Depdc5 UTSW 5 33,132,850 (GRCm39) nonsense probably null
R6132:Depdc5 UTSW 5 33,067,811 (GRCm39) missense probably damaging 0.99
R6146:Depdc5 UTSW 5 33,126,075 (GRCm39) missense probably benign 0.01
R6336:Depdc5 UTSW 5 33,121,851 (GRCm39) splice site probably null
R6468:Depdc5 UTSW 5 33,069,575 (GRCm39) missense probably benign 0.02
R6911:Depdc5 UTSW 5 33,081,536 (GRCm39) missense probably damaging 1.00
R6969:Depdc5 UTSW 5 33,141,204 (GRCm39) missense probably damaging 1.00
R7002:Depdc5 UTSW 5 33,034,502 (GRCm39) splice site probably null
R7066:Depdc5 UTSW 5 33,059,192 (GRCm39) missense probably benign 0.08
R7231:Depdc5 UTSW 5 33,059,209 (GRCm39) missense possibly damaging 0.92
R7264:Depdc5 UTSW 5 33,125,089 (GRCm39) missense probably benign
R7302:Depdc5 UTSW 5 33,136,852 (GRCm39) missense probably damaging 1.00
R7386:Depdc5 UTSW 5 33,085,280 (GRCm39) missense probably benign
R7564:Depdc5 UTSW 5 33,058,854 (GRCm39) missense probably damaging 1.00
R7636:Depdc5 UTSW 5 33,075,327 (GRCm39) missense probably benign
R7795:Depdc5 UTSW 5 33,101,447 (GRCm39) missense probably damaging 1.00
R7845:Depdc5 UTSW 5 33,061,259 (GRCm39) splice site probably null
R8013:Depdc5 UTSW 5 33,131,186 (GRCm39) missense probably benign 0.01
R8037:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8038:Depdc5 UTSW 5 33,116,692 (GRCm39) critical splice donor site probably null
R8065:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8067:Depdc5 UTSW 5 33,053,252 (GRCm39) missense possibly damaging 0.89
R8108:Depdc5 UTSW 5 33,102,393 (GRCm39) missense probably benign 0.01
R8112:Depdc5 UTSW 5 33,126,050 (GRCm39) missense possibly damaging 0.67
R8213:Depdc5 UTSW 5 33,094,981 (GRCm39) missense probably damaging 1.00
R8382:Depdc5 UTSW 5 33,085,242 (GRCm39) missense probably benign 0.00
R8680:Depdc5 UTSW 5 33,101,382 (GRCm39) missense possibly damaging 0.48
R8743:Depdc5 UTSW 5 33,081,587 (GRCm39) missense probably benign 0.10
R8754:Depdc5 UTSW 5 33,136,881 (GRCm39) missense probably benign 0.00
R9157:Depdc5 UTSW 5 33,102,452 (GRCm39) missense probably damaging 0.98
R9364:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9441:Depdc5 UTSW 5 33,095,042 (GRCm39) missense probably benign 0.03
R9450:Depdc5 UTSW 5 33,091,354 (GRCm39) missense probably benign
R9459:Depdc5 UTSW 5 33,148,117 (GRCm39) missense probably damaging 0.99
R9554:Depdc5 UTSW 5 33,122,076 (GRCm39) missense probably benign
R9569:Depdc5 UTSW 5 33,025,321 (GRCm39) missense probably damaging 0.98
R9647:Depdc5 UTSW 5 33,081,567 (GRCm39) missense possibly damaging 0.94
X0027:Depdc5 UTSW 5 33,061,636 (GRCm39) missense probably damaging 1.00
Z1176:Depdc5 UTSW 5 33,100,626 (GRCm39) missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCAAGCATTTTCACATCCTTGG -3'
(R):5'- ACAGACAGATAAAATTTGGACTGTG -3'

Sequencing Primer
(F):5'- TACAGCAGGTCTTCTGACAGCATG -3'
(R):5'- AGAGTACTGACTGCTCTTCCAGAG -3'
Posted On 2022-10-06