Incidental Mutation 'R9689:Skint6'
ID 729029
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R9689 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 113093546 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 199 (F199S)
Ref Sequence ENSEMBL: ENSMUSP00000121870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably damaging
Transcript: ENSMUST00000138966
AA Change: F199S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: F199S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171224
AA Change: F199S

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: F199S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,942,780 (GRCm39) V1538E probably damaging Het
Ank1 T C 8: 23,631,253 (GRCm39) V1833A probably benign Het
Apc2 G A 10: 80,150,733 (GRCm39) R1929Q probably damaging Het
Asb1 A G 1: 91,474,708 (GRCm39) I85V probably damaging Het
Bco2 A T 9: 50,445,938 (GRCm39) I486K probably damaging Het
Braf T A 6: 39,591,084 (GRCm39) I792F probably damaging Het
Cacng2 T C 15: 77,879,399 (GRCm39) K308E possibly damaging Het
Ccr6 G T 17: 8,475,821 (GRCm39) R342L possibly damaging Het
Cdh16 T A 8: 105,341,108 (GRCm39) I802F probably benign Het
Cftr T C 6: 18,313,649 (GRCm39) I1291T probably damaging Het
CN725425 T A 15: 91,120,030 (GRCm39) D50E possibly damaging Het
Cnga1 T C 5: 72,762,170 (GRCm39) Y448C probably benign Het
Cntnap1 T C 11: 101,072,178 (GRCm39) I477T probably damaging Het
Col18a1 G A 10: 76,916,578 (GRCm39) Q366* probably null Het
Csf3 C A 11: 98,592,949 (GRCm39) A104D probably benign Het
Dmbt1 A G 7: 130,660,015 (GRCm39) H422R unknown Het
Dnah12 A G 14: 26,590,871 (GRCm39) D3325G probably null Het
Dnah17 T C 11: 117,963,731 (GRCm39) D2514G probably damaging Het
Fgf9 T A 14: 58,310,680 (GRCm39) H56Q probably damaging Het
Fgfr3 A T 5: 33,892,248 (GRCm39) Y689F probably damaging Het
Fhip2a G A 19: 57,369,710 (GRCm39) V418I probably benign Het
Gar1 A T 3: 129,624,269 (GRCm39) D74E probably damaging Het
Helq T C 5: 100,934,927 (GRCm39) K488E possibly damaging Het
Hmg20a A G 9: 56,381,823 (GRCm39) H33R possibly damaging Het
Igsf10 T C 3: 59,233,624 (GRCm39) D1703G probably damaging Het
Jph3 A T 8: 122,480,377 (GRCm39) I352F probably benign Het
Kng1 T C 16: 22,879,224 (GRCm39) F96S probably damaging Het
Krtap5-2 C A 7: 141,729,029 (GRCm39) S217I unknown Het
Lamp3 T C 16: 19,518,455 (GRCm39) S261G possibly damaging Het
Macf1 A G 4: 123,365,654 (GRCm39) F3036L probably benign Het
Map4k4 G A 1: 40,058,722 (GRCm39) R972H possibly damaging Het
Mccc1 C T 3: 36,030,903 (GRCm39) D388N probably benign Het
Mcoln1 T A 8: 3,557,436 (GRCm39) Y147* probably null Het
Mei1 T C 15: 81,997,129 (GRCm39) S622P Het
Ms4a5 T C 19: 11,254,058 (GRCm39) I136M possibly damaging Het
Nav3 A G 10: 109,605,034 (GRCm39) L1013P probably damaging Het
Ndrg2 T C 14: 52,146,071 (GRCm39) N170S probably damaging Het
Ndufa12 G A 10: 94,035,832 (GRCm39) G40D probably damaging Het
Ogdhl T A 14: 32,059,523 (GRCm39) V390E probably damaging Het
Or10ak12 A C 4: 118,666,999 (GRCm39) S21A probably benign Het
Or1e26 T C 11: 73,479,686 (GRCm39) R293G probably damaging Het
Or4d10 A T 19: 12,051,567 (GRCm39) I143K possibly damaging Het
Or4f6 T A 2: 111,839,124 (GRCm39) M136L probably benign Het
Or8g37 A T 9: 39,731,801 (GRCm39) I289F possibly damaging Het
Osgin1 A G 8: 120,172,247 (GRCm39) D347G possibly damaging Het
Oxct2a A T 4: 123,216,687 (GRCm39) N231K probably damaging Het
Pak6 C T 2: 118,520,243 (GRCm39) T78M probably benign Het
Pde4dip T C 3: 97,649,841 (GRCm39) Y1006C probably damaging Het
Psg18 A G 7: 18,084,880 (GRCm39) I193T probably benign Het
Psmd2 C A 16: 20,479,173 (GRCm39) H677Q probably benign Het
Resf1 T A 6: 149,229,766 (GRCm39) C937* probably null Het
Scaf11 C T 15: 96,316,195 (GRCm39) R1123H probably damaging Het
Setx A T 2: 29,051,555 (GRCm39) S2036C probably damaging Het
Slc3a2 A T 19: 8,686,594 (GRCm39) S367R probably damaging Het
Spidr T C 16: 15,871,304 (GRCm39) D222G probably damaging Het
Styxl1 T C 5: 135,799,190 (GRCm39) E8G probably null Het
Sycp2l T A 13: 41,295,256 (GRCm39) F308I probably damaging Het
Syk A C 13: 52,778,808 (GRCm39) K298T probably benign Het
Tcp11 T A 17: 28,286,028 (GRCm39) Q529L possibly damaging Het
Tgfbi A G 13: 56,762,100 (GRCm39) Y61C probably damaging Het
Tlr9 G A 9: 106,100,721 (GRCm39) R4H probably benign Het
Top2a A C 11: 98,914,883 (GRCm39) S4A probably benign Het
Ttc4 G T 4: 106,528,919 (GRCm39) H166N probably benign Het
Ube2o C A 11: 116,435,639 (GRCm39) R383L possibly damaging Het
Umod A G 7: 119,076,517 (GRCm39) V83A possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4900:Skint6 UTSW 4 112,924,667 (GRCm39) missense probably benign 0.03
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGTCTTTAGAAATCAAGTCAAGGGG -3'
(R):5'- GAGCCCTGTAGCCTTTTCAC -3'

Sequencing Primer
(F):5'- TTAGAAATCAAGTCAAGGGGGAATAG -3'
(R):5'- TGTTTTCAACCAGCTACAAGC -3'
Posted On 2022-10-06