Incidental Mutation 'R9691:Rad51ap2'
ID 729174
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene Name RAD51 associated protein 2
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9691 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 11506080-11512929 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 11509413 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 930 (K930E)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
AlphaFold G3UW63
Predicted Effect possibly damaging
Transcript: ENSMUST00000124065
AA Change: K930E

PolyPhen 2 Score 0.704 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: K930E

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 8,989,090 (GRCm39) M3458T possibly damaging Het
Akap9 T G 5: 4,010,491 (GRCm39) L398R probably damaging Het
Anks3 A T 16: 4,759,840 (GRCm39) C635S probably benign Het
Ankzf1 C A 1: 75,175,196 (GRCm39) Q649K probably benign Het
Atp8a2 T C 14: 60,245,829 (GRCm39) E621G probably damaging Het
Bscl2 A G 19: 8,817,110 (GRCm39) T13A probably benign Het
Cd109 T C 9: 78,611,074 (GRCm39) L1230P possibly damaging Het
Celsr2 T A 3: 108,301,551 (GRCm39) S2678C probably damaging Het
Cnot10 A G 9: 114,420,715 (GRCm39) L709P probably damaging Het
Col5a1 G A 2: 27,842,994 (GRCm39) R449Q unknown Het
Cyp3a25 T A 5: 145,931,732 (GRCm39) E125D probably benign Het
Ddx50 T G 10: 62,476,524 (GRCm39) I250L probably benign Het
Dnah10 A G 5: 124,852,249 (GRCm39) N1859S probably damaging Het
Dnajc13 A G 9: 104,042,211 (GRCm39) L2008P probably damaging Het
Dock4 C T 12: 40,686,097 (GRCm39) L111F probably damaging Het
Ffar3 C G 7: 30,555,119 (GRCm39) R67P probably damaging Het
Gdap2 C T 3: 100,109,441 (GRCm39) A486V probably benign Het
Gm45871 G A 18: 90,610,111 (GRCm39) V450M possibly damaging Het
Golgb1 T A 16: 36,718,996 (GRCm39) S342T probably damaging Het
Grip1 G A 10: 119,874,569 (GRCm39) E778K possibly damaging Het
Grm5 T C 7: 87,723,903 (GRCm39) I731T probably damaging Het
Gxylt2 A T 6: 100,760,109 (GRCm39) T215S probably damaging Het
Jakmip2 A T 18: 43,673,685 (GRCm39) I793N probably damaging Het
Kcnc1 C A 7: 46,076,955 (GRCm39) C252* probably null Het
Kdr T A 5: 76,129,521 (GRCm39) D122V probably damaging Het
Kmt2a G A 9: 44,731,557 (GRCm39) P2920L unknown Het
Lrrc31 T C 3: 30,741,617 (GRCm39) E264G probably damaging Het
Mbnl1 A G 3: 60,529,614 (GRCm39) T256A probably benign Het
Myh3 A G 11: 66,991,921 (GRCm39) E1822G possibly damaging Het
Ndst4 A G 3: 125,518,344 (GRCm39) N155S unknown Het
Negr1 T C 3: 156,267,898 (GRCm39) C23R probably damaging Het
Nfia T A 4: 97,671,465 (GRCm39) D58E probably damaging Het
Nrp1 A T 8: 129,202,650 (GRCm39) N545I probably damaging Het
Nrtn T A 17: 57,059,480 (GRCm39) probably benign Het
Or2a14 A G 6: 43,130,629 (GRCm39) H130R probably benign Het
Or4c100 T C 2: 88,356,421 (GRCm39) F165L probably benign Het
Or5an11 C T 19: 12,246,379 (GRCm39) R262* probably null Het
Pclo G A 5: 14,727,558 (GRCm39) D2139N unknown Het
Phlpp1 C T 1: 106,246,699 (GRCm39) Q630* probably null Het
Pkd1 T C 17: 24,796,812 (GRCm39) V2429A possibly damaging Het
Pramel20 T A 4: 143,299,328 (GRCm39) H330Q probably benign Het
Pramel30 T C 4: 144,056,844 (GRCm39) L9P probably damaging Het
Prkch A G 12: 73,805,730 (GRCm39) K502E probably damaging Het
Reep4 T A 14: 70,785,683 (GRCm39) N204K probably benign Het
Rin2 T C 2: 145,690,764 (GRCm39) L144P probably damaging Het
Scfd2 T C 5: 74,691,611 (GRCm39) S224G possibly damaging Het
Srprb A G 9: 103,069,481 (GRCm39) Y158H probably damaging Het
Thbs4 T A 13: 92,890,896 (GRCm39) H857L probably damaging Het
Tmem184a A G 5: 139,798,790 (GRCm39) L77P possibly damaging Het
Trbv26 G T 6: 41,204,478 (GRCm39) C7F probably benign Het
Trip11 A G 12: 101,850,123 (GRCm39) S1314P probably benign Het
Ttc28 A T 5: 111,431,879 (GRCm39) T1951S probably benign Het
Ttc29 A C 8: 78,972,895 (GRCm39) D115A possibly damaging Het
Upf2 G A 2: 6,032,024 (GRCm39) V857I unknown Het
Vmn2r43 A G 7: 8,247,787 (GRCm39) V792A probably damaging Het
Washc5 A T 15: 59,218,706 (GRCm39) I687N probably damaging Het
Wwc2 G A 8: 48,281,799 (GRCm39) probably benign Het
Xirp2 G A 2: 67,340,539 (GRCm39) E927K possibly damaging Het
Zc3hav1l A G 6: 38,276,112 (GRCm39) F22L probably benign Het
Zfp407 C T 18: 84,578,312 (GRCm39) A934T probably benign Het
Zfp986 T A 4: 145,626,070 (GRCm39) S243R probably benign Het
Zfyve9 T C 4: 108,576,305 (GRCm39) T259A probably benign Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11,508,139 (GRCm39) missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11,508,592 (GRCm39) missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11,506,930 (GRCm39) missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11,506,897 (GRCm39) missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11,507,198 (GRCm39) missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11,508,540 (GRCm39) missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11,507,043 (GRCm39) missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11,507,897 (GRCm39) missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11,508,818 (GRCm39) critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11,507,601 (GRCm39) missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11,506,252 (GRCm39) missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11,508,095 (GRCm39) missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11,507,113 (GRCm39) missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11,507,776 (GRCm39) missense probably benign
R1882:Rad51ap2 UTSW 12 11,506,251 (GRCm39) missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11,507,025 (GRCm39) missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11,507,986 (GRCm39) missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11,507,752 (GRCm39) missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11,507,058 (GRCm39) missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11,507,109 (GRCm39) missense probably benign
R2393:Rad51ap2 UTSW 12 11,507,798 (GRCm39) missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11,508,502 (GRCm39) missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11,507,068 (GRCm39) missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11,507,185 (GRCm39) missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11,506,758 (GRCm39) missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11,507,052 (GRCm39) missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11,508,396 (GRCm39) missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11,506,465 (GRCm39) missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11,507,850 (GRCm39) missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11,507,881 (GRCm39) missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11,506,552 (GRCm39) missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11,507,406 (GRCm39) missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11,507,516 (GRCm39) missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11,509,368 (GRCm39) nonsense probably null
R5517:Rad51ap2 UTSW 12 11,508,313 (GRCm39) missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11,506,921 (GRCm39) missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11,507,534 (GRCm39) small deletion probably benign
R5932:Rad51ap2 UTSW 12 11,508,387 (GRCm39) missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11,508,523 (GRCm39) missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11,507,418 (GRCm39) missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11,507,290 (GRCm39) missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11,507,517 (GRCm39) missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11,507,560 (GRCm39) missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11,508,161 (GRCm39) missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11,507,647 (GRCm39) missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11,507,145 (GRCm39) missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11,507,432 (GRCm39) missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11,506,366 (GRCm39) missense probably benign
R7105:Rad51ap2 UTSW 12 11,508,278 (GRCm39) missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11,506,807 (GRCm39) missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11,507,692 (GRCm39) missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11,507,344 (GRCm39) missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11,507,982 (GRCm39) missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11,507,116 (GRCm39) missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11,506,656 (GRCm39) missense probably benign
R7839:Rad51ap2 UTSW 12 11,507,238 (GRCm39) missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11,512,593 (GRCm39) nonsense probably null
R8040:Rad51ap2 UTSW 12 11,508,792 (GRCm39) missense probably benign 0.03
R8879:Rad51ap2 UTSW 12 11,507,401 (GRCm39) missense possibly damaging 0.55
R8963:Rad51ap2 UTSW 12 11,506,255 (GRCm39) missense possibly damaging 0.91
R9010:Rad51ap2 UTSW 12 11,508,675 (GRCm39) missense probably benign 0.01
R9328:Rad51ap2 UTSW 12 11,507,772 (GRCm39) missense probably benign 0.03
R9712:Rad51ap2 UTSW 12 11,507,593 (GRCm39) missense possibly damaging 0.95
RF023:Rad51ap2 UTSW 12 11,508,076 (GRCm39) missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11,508,097 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTAAATATTAGGAGTCAATCGAAGGC -3'
(R):5'- CTGTTCAGAGGACACCTTCC -3'

Sequencing Primer
(F):5'- CACTTTCTCTAGACAGAGCT -3'
(R):5'- CAAGGTAGTTTCACCATGC -3'
Posted On 2022-10-06