Mutagenetix > Incidental Mutation

Incidental Mutation 'R9695:Plxna4'

729214

Institutional Source

Beutler Lab

Gene Symbol

Plxna4

Ensembl Gene

ENSMUSG00000029765

Gene Name

plexin A4

Synonyms

Plxa4

MMRRC Submission

Accession Numbers

Genbank: NM_175750

Essential gene?

Possibly non essential (E-score: 0.373) question?

Stock #

R9695 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

32144268-32588192 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 32206121 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Serine at position 949 (Y949S)

Ref Sequence

ENSEMBL: ENSMUSP00000110748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115096]

AlphaFold

Q80UG2

Predicted Effect

probably benign
Transcript: ENSMUST00000115096
AA Change: Y949S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: Y949S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	50	490	2.3e-131	SMART
PSI	508	558	2.21e-14	SMART
PSI	654	701	2.44e-7	SMART
PSI	802	855	1.2e-6	SMART
IPT	856	950	7.25e-16	SMART
IPT	952	1036	4.1e-15	SMART
IPT	1038	1138	2.86e-14	SMART
IPT	1140	1229	6.88e-1	SMART
transmembrane domain	1237	1259	N/A	INTRINSIC
Pfam:Plexin_cytopl	1310	1863	1.8e-264	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	T	C	19: 57,182,307	T1A		Het
Adgrl1	G	A	8: 83,938,431	R1249Q	probably damaging	Het
Apeh	G	A	9: 108,086,284	R580C	probably damaging	Het
Armc12	T	A	17: 28,531,019	C46S	probably benign	Het
Avpr1a	C	T	10: 122,448,940	R46C	probably damaging	Het
Cbln4	C	G	2: 172,037,549	G140R	probably damaging	Het
Ccdc89	A	G	7: 90,427,344	N254S	probably benign	Het
Cd96	T	A	16: 46,099,047	I204F	probably damaging	Het
Cel	G	T	2: 28,560,949	L101I	probably damaging	Het
Crtap	A	T	9: 114,386,310	Y170*	probably null	Het
Ctxn3	A	G	18: 57,477,113	M1V	probably null	Het
Cwf19l1	G	T	19: 44,112,986	H478N	probably damaging	Het
Dpysl3	A	T	18: 43,438,127	D27E	probably damaging	Het
Dsg1b	A	G	18: 20,399,332	T478A	probably damaging	Het
Dvl2	G	A	11: 70,009,150	R590Q	possibly damaging	Het
Elovl7	C	A	13: 108,279,708	Q211K	probably damaging	Het
Fech	A	G	18: 64,467,732	I233T	probably damaging	Het
Fsip2	A	T	2: 82,975,882	Q848H	probably benign	Het
Gna15	A	G	10: 81,523,918	C13R	probably damaging	Het
Gstt4	A	T	10: 75,821,238	S65T	probably benign	Het
Heatr1	T	C	13: 12,423,743	V1353A	probably damaging	Het
Hip1r	A	T	5: 124,001,853	K1006N	possibly damaging	Het
Hspg2	T	A	4: 137,538,390	V1804E	probably damaging	Het
Ifi206	T	C	1: 173,473,683	T810A	unknown	Het
Ighv1-69	T	C	12: 115,623,367	T49A	probably benign	Het
Il4i1	A	T	7: 44,839,609	D266V	probably damaging	Het
Itga3	A	T	11: 95,055,694		probably null	Het
Itpr1	A	G	6: 108,401,350	N1279S	probably damaging	Het
Madd	T	C	2: 91,162,584	T997A	probably benign	Het
Mal	C	T	2: 127,640,388	V32I	probably benign	Het
Map9	T	A	3: 82,376,985	S289T	probably benign	Het
Mmp15	G	T	8: 95,370,786	R461L	possibly damaging	Het
Nelfcd	T	A	2: 174,425,130	I395N	probably benign	Het
Neurog2	T	A	3: 127,634,045	V106E	probably damaging	Het
Nup160	T	A	2: 90,708,142	N761K	probably damaging	Het
Oasl1	G	A	5: 114,935,995	R321Q	probably damaging	Het
Olfr1076	T	C	2: 86,508,756	V99A	probably benign	Het
Olfr1412	A	G	1: 92,588,873	D181G	probably benign	Het
Olfr437	A	T	6: 43,167,576	I173L	probably benign	Het
Olfr837	A	G	9: 19,137,875	N294S	probably damaging	Het
Oosp2	T	C	19: 11,651,630	T36A		Het
Otx2	T	G	14: 48,662,495	S16R	probably damaging	Het
Phactr2	A	G	10: 13,474,164	S39P	unknown	Het
Piwil2	A	G	14: 70,389,900	Y797H	possibly damaging	Het
Prss35	A	G	9: 86,755,708	Y177C	probably damaging	Het
Rbm19	T	C	5: 120,197,921	I934T	probably damaging	Het
Rictor	T	G	15: 6,786,529	V1094G	probably benign	Het
Riok1	A	G	13: 38,058,700	T467A	possibly damaging	Het
Slc15a4	G	A	5: 127,617,336	R12W	possibly damaging	Het
Slc44a5	T	A	3: 154,250,951	I280K	probably damaging	Het
Slc9c1	T	C	16: 45,547,663	L205S	probably benign	Het
Slco2a1	A	G	9: 103,084,940	R604G	possibly damaging	Het
Slmap	T	A	14: 26,462,341	T296S	probably damaging	Het
Snrk	T	C	9: 122,166,574	V473A	probably benign	Het
Spg20	A	G	3: 55,126,534	T394A	probably benign	Het
Stil	T	C	4: 115,024,181	S641P	probably damaging	Het
Syne1	A	G	10: 5,318,461	V2076A	probably benign	Het
Tcirg1	G	A	19: 3,902,360	A336V	probably null	Het
Tespa1	T	C	10: 130,362,416	S436P	probably benign	Het
Thumpd3	G	T	6: 113,047,661	R72L	possibly damaging	Het
Tmem70	A	C	1: 16,665,435	E43A	probably benign	Het
Vars	A	G	17: 35,012,588	D696G	possibly damaging	Het
Vwa5b2	A	T	16: 20,604,225	H991L	probably benign	Het
Zfp160	A	G	17: 21,025,484	K99E	possibly damaging	Het
Zfp759	G	A	13: 67,139,134	V250I	possibly damaging	Het
Zmym6	T	C	4: 127,122,547	V707A	probably benign	Het

Other mutations in Plxna4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Plxna4	APN	6	32162091	missense	probably damaging	1.00
IGL01395:Plxna4	APN	6	32239433	missense	probably damaging	0.99
IGL01506:Plxna4	APN	6	32516535	missense	probably damaging	1.00
IGL01606:Plxna4	APN	6	32158001	missense	probably damaging	1.00
IGL01753:Plxna4	APN	6	32310478	missense	probably benign	0.06
IGL01767:Plxna4	APN	6	32237678	missense	possibly damaging	0.51
IGL01968:Plxna4	APN	6	32215204	missense	possibly damaging	0.81
IGL02109:Plxna4	APN	6	32215641	missense	probably benign
IGL02299:Plxna4	APN	6	32165156	missense	probably benign	0.01
IGL02306:Plxna4	APN	6	32206124	missense	probably benign	0.19
IGL02312:Plxna4	APN	6	32165117	missense	possibly damaging	0.79
IGL02326:Plxna4	APN	6	32152905	missense	probably damaging	0.99
IGL02658:Plxna4	APN	6	32185411	missense	probably damaging	1.00
IGL02683:Plxna4	APN	6	32517606	missense	probably benign	0.03
IGL02701:Plxna4	APN	6	32517559	missense	probably benign	0.01
IGL02995:Plxna4	APN	6	32516595	missense	probably damaging	1.00
IGL03030:Plxna4	APN	6	32202225	missense	probably benign	0.01
IGL03264:Plxna4	APN	6	32178402	missense	possibly damaging	0.64
IGL03304:Plxna4	APN	6	32165051	splice site	probably benign
IGL03382:Plxna4	APN	6	32202194	missense	probably benign	0.23
corona	UTSW	6	32517264	missense	probably damaging	1.00
Disposed	UTSW	6	32516505	missense	probably damaging	1.00
inclined	UTSW	6	32237723	nonsense	probably null
Slope	UTSW	6	32234606	missense	probably benign	0.00
G4846:Plxna4	UTSW	6	32192272	missense	probably damaging	1.00
R0133:Plxna4	UTSW	6	32197074	missense	probably benign	0.00
R0200:Plxna4	UTSW	6	32197088	missense	probably damaging	0.99
R0308:Plxna4	UTSW	6	32237768	missense	probably benign	0.01
R0468:Plxna4	UTSW	6	32215246	missense	probably damaging	1.00
R0505:Plxna4	UTSW	6	32202119	missense	probably benign
R0542:Plxna4	UTSW	6	32192297	missense	probably damaging	1.00
R0548:Plxna4	UTSW	6	32158015	missense	probably damaging	1.00
R0652:Plxna4	UTSW	6	32185501	missense	probably damaging	1.00
R1144:Plxna4	UTSW	6	32197156	missense	possibly damaging	0.58
R1190:Plxna4	UTSW	6	32251136	missense	probably damaging	1.00
R1228:Plxna4	UTSW	6	32224152	splice site	probably null
R1569:Plxna4	UTSW	6	32185475	missense	possibly damaging	0.78
R1803:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R1832:Plxna4	UTSW	6	32197826	missense	probably benign	0.01
R2068:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R2157:Plxna4	UTSW	6	32516974	missense	probably benign	0.00
R2842:Plxna4	UTSW	6	32215631	critical splice donor site	probably null
R2849:Plxna4	UTSW	6	32185532	missense	probably damaging	1.00
R2892:Plxna4	UTSW	6	32517037	missense	probably damaging	1.00
R2930:Plxna4	UTSW	6	32165780	missense	probably damaging	1.00
R3892:Plxna4	UTSW	6	32215654	missense	probably damaging	1.00
R4065:Plxna4	UTSW	6	32236365	nonsense	probably null
R4276:Plxna4	UTSW	6	32200948	missense	probably benign	0.29
R4307:Plxna4	UTSW	6	32163509	missense	probably damaging	0.99
R4331:Plxna4	UTSW	6	32150545	nonsense	probably null
R4478:Plxna4	UTSW	6	32196133	missense	possibly damaging	0.89
R4529:Plxna4	UTSW	6	32496896	critical splice acceptor site	probably null
R4566:Plxna4	UTSW	6	32517403	missense	probably benign	0.00
R4568:Plxna4	UTSW	6	32152938	missense	probably damaging	1.00
R4664:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R4685:Plxna4	UTSW	6	32165844	missense	probably damaging	1.00
R4701:Plxna4	UTSW	6	32516688	missense	probably damaging	0.99
R4939:Plxna4	UTSW	6	32165762	missense	probably damaging	1.00
R5153:Plxna4	UTSW	6	32224159	splice site	probably null
R5181:Plxna4	UTSW	6	32516997	missense	probably damaging	1.00
R5256:Plxna4	UTSW	6	32251072	missense	probably benign	0.03
R5259:Plxna4	UTSW	6	32517021	missense	possibly damaging	0.89
R5306:Plxna4	UTSW	6	32206121	missense	probably damaging	0.99
R5487:Plxna4	UTSW	6	32517283	missense	probably damaging	1.00
R5510:Plxna4	UTSW	6	32178358	missense	probably damaging	0.96
R5542:Plxna4	UTSW	6	32206230	missense	probably damaging	1.00
R5567:Plxna4	UTSW	6	32157980	missense	possibly damaging	0.61
R5634:Plxna4	UTSW	6	32237723	nonsense	probably null
R5653:Plxna4	UTSW	6	32517616	missense	possibly damaging	0.66
R5665:Plxna4	UTSW	6	32215722	missense	probably damaging	1.00
R5845:Plxna4	UTSW	6	32237776	missense	probably damaging	1.00
R5909:Plxna4	UTSW	6	32517246	missense	probably damaging	1.00
R5938:Plxna4	UTSW	6	32234606	missense	probably benign	0.00
R5973:Plxna4	UTSW	6	32251065	splice site	probably null
R6433:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6482:Plxna4	UTSW	6	32516737	missense	probably benign
R6560:Plxna4	UTSW	6	32215678	missense	probably damaging	0.97
R6721:Plxna4	UTSW	6	32200859	missense	probably benign	0.26
R6810:Plxna4	UTSW	6	32310522	missense	probably benign	0.18
R6985:Plxna4	UTSW	6	32237708	missense	probably damaging	1.00
R7024:Plxna4	UTSW	6	32192269	missense	probably damaging	1.00
R7046:Plxna4	UTSW	6	32516505	missense	probably damaging	1.00
R7137:Plxna4	UTSW	6	32517264	missense	probably damaging	1.00
R7163:Plxna4	UTSW	6	32496756	missense	probably benign	0.01
R7199:Plxna4	UTSW	6	32215178	nonsense	probably null
R7248:Plxna4	UTSW	6	32162160	missense	probably damaging	0.99
R7260:Plxna4	UTSW	6	32239520	missense	possibly damaging	0.79
R7361:Plxna4	UTSW	6	32196122	critical splice donor site	probably null
R7383:Plxna4	UTSW	6	32152799	critical splice donor site	probably null
R7405:Plxna4	UTSW	6	32196319	missense	probably benign	0.00
R7516:Plxna4	UTSW	6	32237768	missense	probably benign	0.00
R7635:Plxna4	UTSW	6	32496741	missense	probably damaging	0.98
R7754:Plxna4	UTSW	6	32152872	missense	probably damaging	1.00
R7763:Plxna4	UTSW	6	32223980	missense	probably damaging	0.99
R7789:Plxna4	UTSW	6	32206233	critical splice acceptor site	probably null
R8167:Plxna4	UTSW	6	32517046	missense	probably damaging	0.99
R8191:Plxna4	UTSW	6	32516950	missense	possibly damaging	0.88
R8225:Plxna4	UTSW	6	32162103	missense	probably damaging	1.00
R8284:Plxna4	UTSW	6	32152854	missense	probably benign	0.25
R8305:Plxna4	UTSW	6	32211065	missense	possibly damaging	0.81
R8438:Plxna4	UTSW	6	32202180	missense	probably damaging	1.00
R8493:Plxna4	UTSW	6	32215712	missense	probably benign	0.27
R8714:Plxna4	UTSW	6	32163444	nonsense	probably null
R8759:Plxna4	UTSW	6	32192341	missense	probably damaging	1.00
R8822:Plxna4	UTSW	6	32150496	missense	possibly damaging	0.89
R8844:Plxna4	UTSW	6	32197091	missense	probably benign	0.11
R8974:Plxna4	UTSW	6	32239512	missense	possibly damaging	0.79
R9020:Plxna4	UTSW	6	32234562	missense	possibly damaging	0.90
R9144:Plxna4	UTSW	6	32185561	missense	possibly damaging	0.77
R9206:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9208:Plxna4	UTSW	6	32517444	missense	probably damaging	0.98
R9257:Plxna4	UTSW	6	32162083	missense	probably damaging	0.99
R9269:Plxna4	UTSW	6	32178380	missense	probably benign	0.00
R9411:Plxna4	UTSW	6	32182747	missense	probably damaging	1.00
R9469:Plxna4	UTSW	6	32517591	missense	probably benign
R9583:Plxna4	UTSW	6	32215234	missense	possibly damaging	0.78
R9647:Plxna4	UTSW	6	32251109	missense	probably damaging	1.00
R9801:Plxna4	UTSW	6	32163591	critical splice acceptor site	probably null
V1024:Plxna4	UTSW	6	32234574	missense	probably damaging	1.00
X0027:Plxna4	UTSW	6	32517044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTGCAGCCCTATAAGGAGG -3'
(R):5'- CTCACGAAAGCCAGCTTCTG -3'

Sequencing Primer
(F):5'- GAGGCACAAAAGCTAAATCTAGATC -3'
(R):5'- AAAGCCAGCTTCTGTCTCTGGG -3'

Posted On

2022-10-06