Incidental Mutation 'R9695:Itpr1'
ID 729216
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms opt, IP3R1, P400, wblo, Ip3r, Pcp-1, Itpr-1, InsP3R type I, Pcp1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.699) question?
Stock # R9695 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 108190057-108528070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108378311 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1279 (N1279S)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
AlphaFold no structure available at present
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032192
AA Change: N1279S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: N1279S

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000203615
AA Change: N1279S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: N1279S

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,170,739 (GRCm39) T1A Het
Adgrl1 G A 8: 84,665,060 (GRCm39) R1249Q probably damaging Het
Apeh G A 9: 107,963,483 (GRCm39) R580C probably damaging Het
Armc12 T A 17: 28,749,993 (GRCm39) C46S probably benign Het
Avpr1a C T 10: 122,284,845 (GRCm39) R46C probably damaging Het
Cbln4 C G 2: 171,879,469 (GRCm39) G140R probably damaging Het
Ccdc89 A G 7: 90,076,552 (GRCm39) N254S probably benign Het
Cd96 T A 16: 45,919,410 (GRCm39) I204F probably damaging Het
Cel G T 2: 28,450,961 (GRCm39) L101I probably damaging Het
Crtap A T 9: 114,215,378 (GRCm39) Y170* probably null Het
Ctxn3 A G 18: 57,610,185 (GRCm39) M1V probably null Het
Cwf19l1 G T 19: 44,101,425 (GRCm39) H478N probably damaging Het
Dpysl3 A T 18: 43,571,192 (GRCm39) D27E probably damaging Het
Dsg1b A G 18: 20,532,389 (GRCm39) T478A probably damaging Het
Dvl2 G A 11: 69,899,976 (GRCm39) R590Q possibly damaging Het
Elovl7 C A 13: 108,416,242 (GRCm39) Q211K probably damaging Het
Fech A G 18: 64,600,803 (GRCm39) I233T probably damaging Het
Fsip2 A T 2: 82,806,226 (GRCm39) Q848H probably benign Het
Gna15 A G 10: 81,359,752 (GRCm39) C13R probably damaging Het
Gstt4 A T 10: 75,657,072 (GRCm39) S65T probably benign Het
Heatr1 T C 13: 12,438,624 (GRCm39) V1353A probably damaging Het
Hip1r A T 5: 124,139,916 (GRCm39) K1006N possibly damaging Het
Hspg2 T A 4: 137,265,701 (GRCm39) V1804E probably damaging Het
Ifi206 T C 1: 173,301,249 (GRCm39) T810A unknown Het
Ighv1-69 T C 12: 115,586,987 (GRCm39) T49A probably benign Het
Il4i1 A T 7: 44,489,033 (GRCm39) D266V probably damaging Het
Itga3 A T 11: 94,946,520 (GRCm39) probably null Het
Madd T C 2: 90,992,929 (GRCm39) T997A probably benign Het
Mal C T 2: 127,482,308 (GRCm39) V32I probably benign Het
Map9 T A 3: 82,284,292 (GRCm39) S289T probably benign Het
Mmp15 G T 8: 96,097,414 (GRCm39) R461L possibly damaging Het
Nelfcd T A 2: 174,266,923 (GRCm39) I395N probably benign Het
Neurog2 T A 3: 127,427,694 (GRCm39) V106E probably damaging Het
Nup160 T A 2: 90,538,486 (GRCm39) N761K probably damaging Het
Oasl1 G A 5: 115,074,054 (GRCm39) R321Q probably damaging Het
Oosp2 T C 19: 11,628,994 (GRCm39) T36A Het
Or2a52 A T 6: 43,144,510 (GRCm39) I173L probably benign Het
Or7g22 A G 9: 19,049,171 (GRCm39) N294S probably damaging Het
Or8k30 T C 2: 86,339,100 (GRCm39) V99A probably benign Het
Or9s27 A G 1: 92,516,595 (GRCm39) D181G probably benign Het
Otx2 T G 14: 48,899,952 (GRCm39) S16R probably damaging Het
Phactr2 A G 10: 13,349,908 (GRCm39) S39P unknown Het
Piwil2 A G 14: 70,627,349 (GRCm39) Y797H possibly damaging Het
Plxna4 T G 6: 32,183,056 (GRCm39) Y949S probably benign Het
Prss35 A G 9: 86,637,761 (GRCm39) Y177C probably damaging Het
Rbm19 T C 5: 120,335,986 (GRCm39) I934T probably damaging Het
Rictor T G 15: 6,816,010 (GRCm39) V1094G probably benign Het
Riok1 A G 13: 38,242,676 (GRCm39) T467A possibly damaging Het
Slc15a4 G A 5: 127,694,400 (GRCm39) R12W possibly damaging Het
Slc44a5 T A 3: 153,956,588 (GRCm39) I280K probably damaging Het
Slc9c1 T C 16: 45,368,026 (GRCm39) L205S probably benign Het
Slco2a1 A G 9: 102,962,139 (GRCm39) R604G possibly damaging Het
Slmap T A 14: 26,183,496 (GRCm39) T296S probably damaging Het
Snrk T C 9: 121,995,640 (GRCm39) V473A probably benign Het
Spart A G 3: 55,033,955 (GRCm39) T394A probably benign Het
Stil T C 4: 114,881,378 (GRCm39) S641P probably damaging Het
Syne1 A G 10: 5,268,461 (GRCm39) V2076A probably benign Het
Tcirg1 G A 19: 3,952,360 (GRCm39) A336V probably null Het
Tespa1 T C 10: 130,198,285 (GRCm39) S436P probably benign Het
Thumpd3 G T 6: 113,024,622 (GRCm39) R72L possibly damaging Het
Tmem70 A C 1: 16,735,659 (GRCm39) E43A probably benign Het
Vars1 A G 17: 35,231,564 (GRCm39) D696G possibly damaging Het
Vwa5b2 A T 16: 20,422,975 (GRCm39) H991L probably benign Het
Zfp160 A G 17: 21,245,746 (GRCm39) K99E possibly damaging Het
Zfp759 G A 13: 67,287,198 (GRCm39) V250I possibly damaging Het
Zmym6 T C 4: 127,016,340 (GRCm39) V707A probably benign Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,448,081 (GRCm39) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,390,781 (GRCm39) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,358,294 (GRCm39) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,376,322 (GRCm39) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,358,169 (GRCm39) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,316,585 (GRCm39) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,363,688 (GRCm39) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,465,457 (GRCm39) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,450,560 (GRCm39) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,357,993 (GRCm39) nonsense probably null
IGL01969:Itpr1 APN 6 108,354,652 (GRCm39) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,366,444 (GRCm39) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,526,781 (GRCm39) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,394,884 (GRCm39) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,316,478 (GRCm39) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,466,883 (GRCm39) splice site probably null
IGL02568:Itpr1 APN 6 108,316,515 (GRCm39) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,358,276 (GRCm39) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,394,942 (GRCm39) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,500,362 (GRCm39) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,357,871 (GRCm39) unclassified probably benign
aboriginal UTSW 6 108,492,908 (GRCm39) missense probably benign
approximation UTSW 6 108,371,802 (GRCm39) missense probably benign
estimate UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
icarus UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
marsupialized UTSW 6 108,371,034 (GRCm39) splice site probably null
primordial UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
roo UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
wallaby UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,358,218 (GRCm39) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,470,718 (GRCm39) nonsense probably null
R0019:Itpr1 UTSW 6 108,331,587 (GRCm39) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,448,170 (GRCm39) splice site probably benign
R0129:Itpr1 UTSW 6 108,326,637 (GRCm39) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,465,443 (GRCm39) splice site probably benign
R0244:Itpr1 UTSW 6 108,450,550 (GRCm39) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,355,128 (GRCm39) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,492,709 (GRCm39) splice site probably benign
R0647:Itpr1 UTSW 6 108,360,659 (GRCm39) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,326,590 (GRCm39) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,487,657 (GRCm39) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,316,582 (GRCm39) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,326,620 (GRCm39) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,459,858 (GRCm39) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,363,667 (GRCm39) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,417,497 (GRCm39) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,363,814 (GRCm39) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,355,270 (GRCm39) unclassified probably benign
R2166:Itpr1 UTSW 6 108,365,186 (GRCm39) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,346,071 (GRCm39) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,383,070 (GRCm39) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,326,641 (GRCm39) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,358,231 (GRCm39) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,371,802 (GRCm39) missense probably benign
R4081:Itpr1 UTSW 6 108,368,796 (GRCm39) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,371,316 (GRCm39) missense probably benign
R4406:Itpr1 UTSW 6 108,331,624 (GRCm39) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,409,647 (GRCm39) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,458,184 (GRCm39) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,458,254 (GRCm39) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,387,892 (GRCm39) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,326,593 (GRCm39) missense probably benign 0.29
R4836:Itpr1 UTSW 6 108,366,498 (GRCm39) missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,459,867 (GRCm39) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,417,519 (GRCm39) nonsense probably null
R5076:Itpr1 UTSW 6 108,382,490 (GRCm39) splice site probably null
R5088:Itpr1 UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,519,023 (GRCm39) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,383,106 (GRCm39) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,333,472 (GRCm39) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,370,922 (GRCm39) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,364,459 (GRCm39) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,496,385 (GRCm39) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,470,755 (GRCm39) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,465,561 (GRCm39) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,329,104 (GRCm39) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,450,490 (GRCm39) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,466,758 (GRCm39) intron probably benign
R5929:Itpr1 UTSW 6 108,400,297 (GRCm39) missense probably benign
R5956:Itpr1 UTSW 6 108,482,988 (GRCm39) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,365,245 (GRCm39) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,346,077 (GRCm39) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,355,164 (GRCm39) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,482,864 (GRCm39) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,394,933 (GRCm39) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,365,237 (GRCm39) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,340,644 (GRCm39) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,371,034 (GRCm39) splice site probably null
R6806:Itpr1 UTSW 6 108,492,908 (GRCm39) missense probably benign
R6838:Itpr1 UTSW 6 108,448,152 (GRCm39) missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108,365,153 (GRCm39) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,458,355 (GRCm39) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,408,459 (GRCm39) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,365,257 (GRCm39) missense probably benign
R7116:Itpr1 UTSW 6 108,458,229 (GRCm39) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,371,368 (GRCm39) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,363,601 (GRCm39) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,355,151 (GRCm39) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,494,581 (GRCm39) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,518,985 (GRCm39) missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108,415,292 (GRCm39) missense probably benign 0.28
R7449:Itpr1 UTSW 6 108,366,345 (GRCm39) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,380,357 (GRCm39) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,360,639 (GRCm39) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,500,309 (GRCm39) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,459,892 (GRCm39) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,364,330 (GRCm39) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,500,366 (GRCm39) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,394,909 (GRCm39) missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108,363,589 (GRCm39) missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108,415,321 (GRCm39) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,371,826 (GRCm39) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,363,658 (GRCm39) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,365,190 (GRCm39) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,340,581 (GRCm39) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,496,309 (GRCm39) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,370,928 (GRCm39) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,500,327 (GRCm39) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,354,763 (GRCm39) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,365,172 (GRCm39) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,355,159 (GRCm39) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,470,666 (GRCm39) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,364,352 (GRCm39) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,466,810 (GRCm39) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,370,984 (GRCm39) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,328,979 (GRCm39) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,326,638 (GRCm39) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,390,837 (GRCm39) missense probably benign
R9428:Itpr1 UTSW 6 108,378,308 (GRCm39) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,393,870 (GRCm39) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,371,845 (GRCm39) missense probably damaging 1.00
R9710:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9721:Itpr1 UTSW 6 108,383,063 (GRCm39) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,487,795 (GRCm39) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,476,110 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACCTTTTCAAAAGCCGTTTG -3'
(R):5'- TCACCTCAGCCATGACCATG -3'

Sequencing Primer
(F):5'- AACCAGGACTTTGCTGGCTAATG -3'
(R):5'- TCAGCCATGACCATGTCTTG -3'
Posted On 2022-10-06