Incidental Mutation 'R9695:Mmp15'
ID 729221
Institutional Source Beutler Lab
Gene Symbol Mmp15
Ensembl Gene ENSMUSG00000031790
Gene Name matrix metallopeptidase 15
Synonyms Membrane type 2-MMP, MT2-MMP
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9695 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95352268-95375080 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 95370786 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 461 (R461L)
Ref Sequence ENSEMBL: ENSMUSP00000034243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034243]
AlphaFold O54732
Predicted Effect possibly damaging
Transcript: ENSMUST00000034243
AA Change: R461L

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000034243
Gene: ENSMUSG00000031790
AA Change: R461L

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
Pfam:PG_binding_1 42 102 3.2e-13 PFAM
ZnMc 131 301 5.31e-59 SMART
low complexity region 306 353 N/A INTRINSIC
HX 370 413 5.92e-8 SMART
HX 415 459 2.31e-10 SMART
HX 462 508 2.98e-13 SMART
HX 510 555 2.01e-10 SMART
Pfam:DUF3377 586 657 1.2e-32 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family of extracellular matrix-degrading enzymes that are involved in tissue remodeling, wound repair, progression of atherosclerosis and tumor invasion. The encoded preproprotein undergoes proteolytic processing to generate a mature, zinc-dependent endopeptidase enzyme. A deficiency of the encoded protein in mice is compatible with normal development and postnatal growth. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,182,307 T1A Het
Adgrl1 G A 8: 83,938,431 R1249Q probably damaging Het
Apeh G A 9: 108,086,284 R580C probably damaging Het
Armc12 T A 17: 28,531,019 C46S probably benign Het
Avpr1a C T 10: 122,448,940 R46C probably damaging Het
Cbln4 C G 2: 172,037,549 G140R probably damaging Het
Ccdc89 A G 7: 90,427,344 N254S probably benign Het
Cd96 T A 16: 46,099,047 I204F probably damaging Het
Cel G T 2: 28,560,949 L101I probably damaging Het
Crtap A T 9: 114,386,310 Y170* probably null Het
Ctxn3 A G 18: 57,477,113 M1V probably null Het
Cwf19l1 G T 19: 44,112,986 H478N probably damaging Het
Dpysl3 A T 18: 43,438,127 D27E probably damaging Het
Dsg1b A G 18: 20,399,332 T478A probably damaging Het
Dvl2 G A 11: 70,009,150 R590Q possibly damaging Het
Elovl7 C A 13: 108,279,708 Q211K probably damaging Het
Fech A G 18: 64,467,732 I233T probably damaging Het
Fsip2 A T 2: 82,975,882 Q848H probably benign Het
Gna15 A G 10: 81,523,918 C13R probably damaging Het
Gstt4 A T 10: 75,821,238 S65T probably benign Het
Heatr1 T C 13: 12,423,743 V1353A probably damaging Het
Hip1r A T 5: 124,001,853 K1006N possibly damaging Het
Hspg2 T A 4: 137,538,390 V1804E probably damaging Het
Ifi206 T C 1: 173,473,683 T810A unknown Het
Ighv1-69 T C 12: 115,623,367 T49A probably benign Het
Il4i1 A T 7: 44,839,609 D266V probably damaging Het
Itga3 A T 11: 95,055,694 probably null Het
Itpr1 A G 6: 108,401,350 N1279S probably damaging Het
Madd T C 2: 91,162,584 T997A probably benign Het
Mal C T 2: 127,640,388 V32I probably benign Het
Map9 T A 3: 82,376,985 S289T probably benign Het
Nelfcd T A 2: 174,425,130 I395N probably benign Het
Neurog2 T A 3: 127,634,045 V106E probably damaging Het
Nup160 T A 2: 90,708,142 N761K probably damaging Het
Oasl1 G A 5: 114,935,995 R321Q probably damaging Het
Olfr1076 T C 2: 86,508,756 V99A probably benign Het
Olfr1412 A G 1: 92,588,873 D181G probably benign Het
Olfr437 A T 6: 43,167,576 I173L probably benign Het
Olfr837 A G 9: 19,137,875 N294S probably damaging Het
Oosp2 T C 19: 11,651,630 T36A Het
Otx2 T G 14: 48,662,495 S16R probably damaging Het
Phactr2 A G 10: 13,474,164 S39P unknown Het
Piwil2 A G 14: 70,389,900 Y797H possibly damaging Het
Plxna4 T G 6: 32,206,121 Y949S probably benign Het
Prss35 A G 9: 86,755,708 Y177C probably damaging Het
Rbm19 T C 5: 120,197,921 I934T probably damaging Het
Rictor T G 15: 6,786,529 V1094G probably benign Het
Riok1 A G 13: 38,058,700 T467A possibly damaging Het
Slc15a4 G A 5: 127,617,336 R12W possibly damaging Het
Slc44a5 T A 3: 154,250,951 I280K probably damaging Het
Slc9c1 T C 16: 45,547,663 L205S probably benign Het
Slco2a1 A G 9: 103,084,940 R604G possibly damaging Het
Slmap T A 14: 26,462,341 T296S probably damaging Het
Snrk T C 9: 122,166,574 V473A probably benign Het
Spg20 A G 3: 55,126,534 T394A probably benign Het
Stil T C 4: 115,024,181 S641P probably damaging Het
Syne1 A G 10: 5,318,461 V2076A probably benign Het
Tcirg1 G A 19: 3,902,360 A336V probably null Het
Tespa1 T C 10: 130,362,416 S436P probably benign Het
Thumpd3 G T 6: 113,047,661 R72L possibly damaging Het
Tmem70 A C 1: 16,665,435 E43A probably benign Het
Vars A G 17: 35,012,588 D696G possibly damaging Het
Vwa5b2 A T 16: 20,604,225 H991L probably benign Het
Zfp160 A G 17: 21,025,484 K99E possibly damaging Het
Zfp759 G A 13: 67,139,134 V250I possibly damaging Het
Zmym6 T C 4: 127,122,547 V707A probably benign Het
Other mutations in Mmp15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01467:Mmp15 APN 8 95366331 missense probably benign 0.31
IGL03001:Mmp15 APN 8 95368217 missense probably damaging 0.97
R0147:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0148:Mmp15 UTSW 8 95372317 missense probably benign 0.18
R0437:Mmp15 UTSW 8 95370772 missense probably benign 0.04
R0465:Mmp15 UTSW 8 95367998 missense probably damaging 1.00
R0548:Mmp15 UTSW 8 95372351 missense probably damaging 1.00
R0574:Mmp15 UTSW 8 95365401 missense possibly damaging 0.73
R0685:Mmp15 UTSW 8 95372134 missense possibly damaging 0.81
R0763:Mmp15 UTSW 8 95368228 missense probably benign 0.01
R1341:Mmp15 UTSW 8 95372303 missense probably benign 0.03
R1428:Mmp15 UTSW 8 95369562 missense probably benign 0.34
R1840:Mmp15 UTSW 8 95365420 missense probably damaging 1.00
R2061:Mmp15 UTSW 8 95370779 missense possibly damaging 0.91
R2219:Mmp15 UTSW 8 95370173 missense probably benign 0.38
R4760:Mmp15 UTSW 8 95368196 missense possibly damaging 0.61
R4762:Mmp15 UTSW 8 95372330 missense probably benign 0.00
R5233:Mmp15 UTSW 8 95371068 missense probably benign 0.08
R5394:Mmp15 UTSW 8 95366404 missense probably damaging 0.96
R5502:Mmp15 UTSW 8 95368184 missense possibly damaging 0.96
R5543:Mmp15 UTSW 8 95368101 missense possibly damaging 0.85
R6027:Mmp15 UTSW 8 95372176 missense probably benign 0.00
R6341:Mmp15 UTSW 8 95365463 critical splice donor site probably null
R6720:Mmp15 UTSW 8 95365314 missense probably benign 0.22
R7788:Mmp15 UTSW 8 95368148 missense probably damaging 1.00
R8033:Mmp15 UTSW 8 95367962 missense probably benign 0.01
R8679:Mmp15 UTSW 8 95366354 missense possibly damaging 0.83
R8791:Mmp15 UTSW 8 95369660 nonsense probably null
R9028:Mmp15 UTSW 8 95369688 missense probably benign 0.01
R9227:Mmp15 UTSW 8 95366331 missense probably benign 0.06
R9230:Mmp15 UTSW 8 95366331 missense probably benign 0.06
R9350:Mmp15 UTSW 8 95366374 missense probably damaging 0.97
R9632:Mmp15 UTSW 8 95372103 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATGAGCATCTCGCAGGTGG -3'
(R):5'- CTATGACCAGAAGCATCAGGC -3'

Sequencing Primer
(F):5'- ATCTCGCAGGTGGCCATG -3'
(R):5'- AGGCTGTGAACCTGGAGC -3'
Posted On 2022-10-06