Incidental Mutation 'R9695:Slc9c1'
ID 729246
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, Slc9a10, spermNHE
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock # R9695 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45535309-45607001 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45547663 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 205 (L205S)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: L205S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: L205S

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162151
AA Change: L176S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,182,307 T1A Het
Adgrl1 G A 8: 83,938,431 R1249Q probably damaging Het
Apeh G A 9: 108,086,284 R580C probably damaging Het
Armc12 T A 17: 28,531,019 C46S probably benign Het
Avpr1a C T 10: 122,448,940 R46C probably damaging Het
Cbln4 C G 2: 172,037,549 G140R probably damaging Het
Ccdc89 A G 7: 90,427,344 N254S probably benign Het
Cd96 T A 16: 46,099,047 I204F probably damaging Het
Cel G T 2: 28,560,949 L101I probably damaging Het
Crtap A T 9: 114,386,310 Y170* probably null Het
Ctxn3 A G 18: 57,477,113 M1V probably null Het
Cwf19l1 G T 19: 44,112,986 H478N probably damaging Het
Dpysl3 A T 18: 43,438,127 D27E probably damaging Het
Dsg1b A G 18: 20,399,332 T478A probably damaging Het
Dvl2 G A 11: 70,009,150 R590Q possibly damaging Het
Elovl7 C A 13: 108,279,708 Q211K probably damaging Het
Fech A G 18: 64,467,732 I233T probably damaging Het
Fsip2 A T 2: 82,975,882 Q848H probably benign Het
Gna15 A G 10: 81,523,918 C13R probably damaging Het
Gstt4 A T 10: 75,821,238 S65T probably benign Het
Heatr1 T C 13: 12,423,743 V1353A probably damaging Het
Hip1r A T 5: 124,001,853 K1006N possibly damaging Het
Hspg2 T A 4: 137,538,390 V1804E probably damaging Het
Ifi206 T C 1: 173,473,683 T810A unknown Het
Ighv1-69 T C 12: 115,623,367 T49A probably benign Het
Il4i1 A T 7: 44,839,609 D266V probably damaging Het
Itga3 A T 11: 95,055,694 probably null Het
Itpr1 A G 6: 108,401,350 N1279S probably damaging Het
Madd T C 2: 91,162,584 T997A probably benign Het
Mal C T 2: 127,640,388 V32I probably benign Het
Map9 T A 3: 82,376,985 S289T probably benign Het
Mmp15 G T 8: 95,370,786 R461L possibly damaging Het
Nelfcd T A 2: 174,425,130 I395N probably benign Het
Neurog2 T A 3: 127,634,045 V106E probably damaging Het
Nup160 T A 2: 90,708,142 N761K probably damaging Het
Oasl1 G A 5: 114,935,995 R321Q probably damaging Het
Olfr1076 T C 2: 86,508,756 V99A probably benign Het
Olfr1412 A G 1: 92,588,873 D181G probably benign Het
Olfr437 A T 6: 43,167,576 I173L probably benign Het
Olfr837 A G 9: 19,137,875 N294S probably damaging Het
Oosp2 T C 19: 11,651,630 T36A Het
Otx2 T G 14: 48,662,495 S16R probably damaging Het
Phactr2 A G 10: 13,474,164 S39P unknown Het
Piwil2 A G 14: 70,389,900 Y797H possibly damaging Het
Plxna4 T G 6: 32,206,121 Y949S probably benign Het
Prss35 A G 9: 86,755,708 Y177C probably damaging Het
Rbm19 T C 5: 120,197,921 I934T probably damaging Het
Rictor T G 15: 6,786,529 V1094G probably benign Het
Riok1 A G 13: 38,058,700 T467A possibly damaging Het
Slc15a4 G A 5: 127,617,336 R12W possibly damaging Het
Slc44a5 T A 3: 154,250,951 I280K probably damaging Het
Slco2a1 A G 9: 103,084,940 R604G possibly damaging Het
Slmap T A 14: 26,462,341 T296S probably damaging Het
Snrk T C 9: 122,166,574 V473A probably benign Het
Spg20 A G 3: 55,126,534 T394A probably benign Het
Stil T C 4: 115,024,181 S641P probably damaging Het
Syne1 A G 10: 5,318,461 V2076A probably benign Het
Tcirg1 G A 19: 3,902,360 A336V probably null Het
Tespa1 T C 10: 130,362,416 S436P probably benign Het
Thumpd3 G T 6: 113,047,661 R72L possibly damaging Het
Tmem70 A C 1: 16,665,435 E43A probably benign Het
Vars A G 17: 35,012,588 D696G possibly damaging Het
Vwa5b2 A T 16: 20,604,225 H991L probably benign Het
Zfp160 A G 17: 21,025,484 K99E possibly damaging Het
Zfp759 G A 13: 67,139,134 V250I possibly damaging Het
Zmym6 T C 4: 127,122,547 V707A probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45573389 missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45539639 missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45593358 missense probably benign
IGL01287:Slc9c1 APN 16 45584448 nonsense probably null
IGL01536:Slc9c1 APN 16 45589629 critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45582972 missense probably benign
IGL01671:Slc9c1 APN 16 45560315 missense probably benign
IGL01720:Slc9c1 APN 16 45555769 missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45541461 missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45599470 missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45556614 missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45580142 missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45577875 missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45550185 missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45581598 missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45575419 missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45543261 splice site probably benign
IGL03062:Slc9c1 APN 16 45599758 missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45547640 missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45543168 missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45550161 missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45606856 utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45575420 missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45554300 missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45580232 missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45599887 splice site probably benign
R0611:Slc9c1 UTSW 16 45581602 missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45573356 missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45543120 splice site probably benign
R1106:Slc9c1 UTSW 16 45555807 missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45601961 missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45552928 missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45589509 missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45554289 missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45558281 missense probably benign
R1813:Slc9c1 UTSW 16 45573347 missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45593472 missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45550106 missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45554255 missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45580250 missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45593464 missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45544736 missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45580219 missense probably benign
R3765:Slc9c1 UTSW 16 45590881 missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45606830 utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45543230 missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45544791 missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45599466 missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45547393 makesense probably null
R4928:Slc9c1 UTSW 16 45575409 missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45544831 missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45593437 missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45554246 missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45556614 missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45544760 missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45547668 missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45575368 missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45555769 missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45606841 utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45577831 missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45550116 missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45581515 missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45593484 missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45577893 missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45582969 missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45539713 missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45582981 missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45547695 missense probably benign
R8328:Slc9c1 UTSW 16 45577864 missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45593371 missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45606819 missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45560283 missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45580127 missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45599781 missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45577912 missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45550188 missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45593485 missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45575407 missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45560342 missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45580214 missense possibly damaging 0.72
R9742:Slc9c1 UTSW 16 45580253 missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45577899 missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45558238 missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45573419 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATGTGTGTCCTTTGGGAAGAAAAC -3'
(R):5'- ATGTGCAGGTCAAGTCAGC -3'

Sequencing Primer
(F):5'- TCCTTTGGGAAGAAAACTGCTAGAC -3'
(R):5'- GTCAAGTCAGCCTGCCAATACTTG -3'
Posted On 2022-10-06