Incidental Mutation 'R9695:Slc9c1'
ID 729246
Institutional Source Beutler Lab
Gene Symbol Slc9c1
Ensembl Gene ENSMUSG00000033210
Gene Name solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1
Synonyms LOC208169, spermNHE, Slc9a10
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.458) question?
Stock # R9695 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 45355672-45427364 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45368026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 205 (L205S)
Ref Sequence ENSEMBL: ENSMUSP00000124969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159945]
AlphaFold Q6UJY2
Predicted Effect probably benign
Transcript: ENSMUST00000159945
AA Change: L205S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124969
Gene: ENSMUSG00000033210
AA Change: L205S

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 40 445 2.3e-31 PFAM
low complexity region 588 602 N/A INTRINSIC
transmembrane domain 635 654 N/A INTRINSIC
transmembrane domain 669 686 N/A INTRINSIC
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
cNMP 890 1026 4.99e-1 SMART
low complexity region 1161 1175 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162151
AA Change: L176S

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000162774
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC9A10 is a member of the sodium-hydrogen exchanger (NHE) family (see SLC9A1, MIM 107310) and is required for male fertility and sperm motility (Wang et al., 2003 [PubMed 14634667]).[supplied by OMIM, Apr 2009]
PHENOTYPE: Homozygous null mice display male infertility and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 T C 19: 57,170,739 (GRCm39) T1A Het
Adgrl1 G A 8: 84,665,060 (GRCm39) R1249Q probably damaging Het
Apeh G A 9: 107,963,483 (GRCm39) R580C probably damaging Het
Armc12 T A 17: 28,749,993 (GRCm39) C46S probably benign Het
Avpr1a C T 10: 122,284,845 (GRCm39) R46C probably damaging Het
Cbln4 C G 2: 171,879,469 (GRCm39) G140R probably damaging Het
Ccdc89 A G 7: 90,076,552 (GRCm39) N254S probably benign Het
Cd96 T A 16: 45,919,410 (GRCm39) I204F probably damaging Het
Cel G T 2: 28,450,961 (GRCm39) L101I probably damaging Het
Crtap A T 9: 114,215,378 (GRCm39) Y170* probably null Het
Ctxn3 A G 18: 57,610,185 (GRCm39) M1V probably null Het
Cwf19l1 G T 19: 44,101,425 (GRCm39) H478N probably damaging Het
Dpysl3 A T 18: 43,571,192 (GRCm39) D27E probably damaging Het
Dsg1b A G 18: 20,532,389 (GRCm39) T478A probably damaging Het
Dvl2 G A 11: 69,899,976 (GRCm39) R590Q possibly damaging Het
Elovl7 C A 13: 108,416,242 (GRCm39) Q211K probably damaging Het
Fech A G 18: 64,600,803 (GRCm39) I233T probably damaging Het
Fsip2 A T 2: 82,806,226 (GRCm39) Q848H probably benign Het
Gna15 A G 10: 81,359,752 (GRCm39) C13R probably damaging Het
Gstt4 A T 10: 75,657,072 (GRCm39) S65T probably benign Het
Heatr1 T C 13: 12,438,624 (GRCm39) V1353A probably damaging Het
Hip1r A T 5: 124,139,916 (GRCm39) K1006N possibly damaging Het
Hspg2 T A 4: 137,265,701 (GRCm39) V1804E probably damaging Het
Ifi206 T C 1: 173,301,249 (GRCm39) T810A unknown Het
Ighv1-69 T C 12: 115,586,987 (GRCm39) T49A probably benign Het
Il4i1 A T 7: 44,489,033 (GRCm39) D266V probably damaging Het
Itga3 A T 11: 94,946,520 (GRCm39) probably null Het
Itpr1 A G 6: 108,378,311 (GRCm39) N1279S probably damaging Het
Madd T C 2: 90,992,929 (GRCm39) T997A probably benign Het
Mal C T 2: 127,482,308 (GRCm39) V32I probably benign Het
Map9 T A 3: 82,284,292 (GRCm39) S289T probably benign Het
Mmp15 G T 8: 96,097,414 (GRCm39) R461L possibly damaging Het
Nelfcd T A 2: 174,266,923 (GRCm39) I395N probably benign Het
Neurog2 T A 3: 127,427,694 (GRCm39) V106E probably damaging Het
Nup160 T A 2: 90,538,486 (GRCm39) N761K probably damaging Het
Oasl1 G A 5: 115,074,054 (GRCm39) R321Q probably damaging Het
Oosp2 T C 19: 11,628,994 (GRCm39) T36A Het
Or2a52 A T 6: 43,144,510 (GRCm39) I173L probably benign Het
Or7g22 A G 9: 19,049,171 (GRCm39) N294S probably damaging Het
Or8k30 T C 2: 86,339,100 (GRCm39) V99A probably benign Het
Or9s27 A G 1: 92,516,595 (GRCm39) D181G probably benign Het
Otx2 T G 14: 48,899,952 (GRCm39) S16R probably damaging Het
Phactr2 A G 10: 13,349,908 (GRCm39) S39P unknown Het
Piwil2 A G 14: 70,627,349 (GRCm39) Y797H possibly damaging Het
Plxna4 T G 6: 32,183,056 (GRCm39) Y949S probably benign Het
Prss35 A G 9: 86,637,761 (GRCm39) Y177C probably damaging Het
Rbm19 T C 5: 120,335,986 (GRCm39) I934T probably damaging Het
Rictor T G 15: 6,816,010 (GRCm39) V1094G probably benign Het
Riok1 A G 13: 38,242,676 (GRCm39) T467A possibly damaging Het
Slc15a4 G A 5: 127,694,400 (GRCm39) R12W possibly damaging Het
Slc44a5 T A 3: 153,956,588 (GRCm39) I280K probably damaging Het
Slco2a1 A G 9: 102,962,139 (GRCm39) R604G possibly damaging Het
Slmap T A 14: 26,183,496 (GRCm39) T296S probably damaging Het
Snrk T C 9: 121,995,640 (GRCm39) V473A probably benign Het
Spart A G 3: 55,033,955 (GRCm39) T394A probably benign Het
Stil T C 4: 114,881,378 (GRCm39) S641P probably damaging Het
Syne1 A G 10: 5,268,461 (GRCm39) V2076A probably benign Het
Tcirg1 G A 19: 3,952,360 (GRCm39) A336V probably null Het
Tespa1 T C 10: 130,198,285 (GRCm39) S436P probably benign Het
Thumpd3 G T 6: 113,024,622 (GRCm39) R72L possibly damaging Het
Tmem70 A C 1: 16,735,659 (GRCm39) E43A probably benign Het
Vars1 A G 17: 35,231,564 (GRCm39) D696G possibly damaging Het
Vwa5b2 A T 16: 20,422,975 (GRCm39) H991L probably benign Het
Zfp160 A G 17: 21,245,746 (GRCm39) K99E possibly damaging Het
Zfp759 G A 13: 67,287,198 (GRCm39) V250I possibly damaging Het
Zmym6 T C 4: 127,016,340 (GRCm39) V707A probably benign Het
Other mutations in Slc9c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc9c1 APN 16 45,393,752 (GRCm39) missense possibly damaging 0.93
IGL00510:Slc9c1 APN 16 45,360,002 (GRCm39) missense probably benign 0.00
IGL00949:Slc9c1 APN 16 45,413,721 (GRCm39) missense probably benign
IGL01287:Slc9c1 APN 16 45,404,811 (GRCm39) nonsense probably null
IGL01536:Slc9c1 APN 16 45,409,992 (GRCm39) critical splice donor site probably null
IGL01655:Slc9c1 APN 16 45,403,335 (GRCm39) missense probably benign
IGL01671:Slc9c1 APN 16 45,380,678 (GRCm39) missense probably benign
IGL01720:Slc9c1 APN 16 45,376,132 (GRCm39) missense probably damaging 1.00
IGL01758:Slc9c1 APN 16 45,361,824 (GRCm39) missense probably damaging 1.00
IGL02031:Slc9c1 APN 16 45,419,833 (GRCm39) missense probably benign 0.00
IGL02321:Slc9c1 APN 16 45,376,977 (GRCm39) missense probably benign 0.02
IGL02472:Slc9c1 APN 16 45,400,505 (GRCm39) missense probably benign 0.10
IGL02516:Slc9c1 APN 16 45,398,238 (GRCm39) missense probably damaging 0.96
IGL02732:Slc9c1 APN 16 45,370,548 (GRCm39) missense possibly damaging 0.78
IGL02741:Slc9c1 APN 16 45,401,961 (GRCm39) missense possibly damaging 0.48
IGL02795:Slc9c1 APN 16 45,395,782 (GRCm39) missense probably benign 0.06
IGL03032:Slc9c1 APN 16 45,363,624 (GRCm39) splice site probably benign
IGL03062:Slc9c1 APN 16 45,420,121 (GRCm39) missense probably benign 0.20
IGL03184:Slc9c1 APN 16 45,368,003 (GRCm39) missense probably damaging 1.00
IGL03351:Slc9c1 APN 16 45,363,531 (GRCm39) missense probably benign 0.01
P0041:Slc9c1 UTSW 16 45,370,524 (GRCm39) missense possibly damaging 0.65
R0052:Slc9c1 UTSW 16 45,427,219 (GRCm39) utr 3 prime probably benign
R0107:Slc9c1 UTSW 16 45,395,783 (GRCm39) missense probably benign 0.00
R0255:Slc9c1 UTSW 16 45,374,663 (GRCm39) missense probably benign 0.25
R0316:Slc9c1 UTSW 16 45,400,595 (GRCm39) missense possibly damaging 0.72
R0437:Slc9c1 UTSW 16 45,420,250 (GRCm39) splice site probably benign
R0611:Slc9c1 UTSW 16 45,401,965 (GRCm39) missense possibly damaging 0.83
R0624:Slc9c1 UTSW 16 45,393,719 (GRCm39) missense probably benign 0.00
R0630:Slc9c1 UTSW 16 45,363,483 (GRCm39) splice site probably benign
R1106:Slc9c1 UTSW 16 45,376,170 (GRCm39) missense possibly damaging 0.66
R1396:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1727:Slc9c1 UTSW 16 45,422,324 (GRCm39) missense probably benign 0.27
R1732:Slc9c1 UTSW 16 45,373,291 (GRCm39) missense probably benign 0.21
R1754:Slc9c1 UTSW 16 45,409,872 (GRCm39) missense probably benign 0.11
R1799:Slc9c1 UTSW 16 45,374,652 (GRCm39) missense probably damaging 1.00
R1802:Slc9c1 UTSW 16 45,378,644 (GRCm39) missense probably benign
R1813:Slc9c1 UTSW 16 45,393,710 (GRCm39) missense probably benign 0.43
R1972:Slc9c1 UTSW 16 45,413,835 (GRCm39) missense possibly damaging 0.89
R1985:Slc9c1 UTSW 16 45,370,469 (GRCm39) missense probably benign 0.01
R1995:Slc9c1 UTSW 16 45,374,618 (GRCm39) missense probably damaging 0.99
R2045:Slc9c1 UTSW 16 45,400,613 (GRCm39) missense probably damaging 1.00
R2146:Slc9c1 UTSW 16 45,413,827 (GRCm39) missense probably benign 0.19
R2511:Slc9c1 UTSW 16 45,365,099 (GRCm39) missense possibly damaging 0.79
R3716:Slc9c1 UTSW 16 45,400,582 (GRCm39) missense probably benign
R3765:Slc9c1 UTSW 16 45,411,244 (GRCm39) missense possibly damaging 0.89
R3936:Slc9c1 UTSW 16 45,427,193 (GRCm39) utr 3 prime probably benign
R4051:Slc9c1 UTSW 16 45,363,593 (GRCm39) missense probably damaging 1.00
R4302:Slc9c1 UTSW 16 45,365,154 (GRCm39) missense probably benign 0.35
R4433:Slc9c1 UTSW 16 45,419,829 (GRCm39) missense possibly damaging 0.93
R4651:Slc9c1 UTSW 16 45,367,756 (GRCm39) makesense probably null
R4928:Slc9c1 UTSW 16 45,395,772 (GRCm39) missense probably benign 0.42
R4957:Slc9c1 UTSW 16 45,365,194 (GRCm39) missense probably benign 0.45
R4989:Slc9c1 UTSW 16 45,413,800 (GRCm39) missense probably benign 0.03
R5478:Slc9c1 UTSW 16 45,374,609 (GRCm39) missense probably damaging 1.00
R5534:Slc9c1 UTSW 16 45,376,977 (GRCm39) missense probably benign 0.00
R5898:Slc9c1 UTSW 16 45,365,123 (GRCm39) missense probably damaging 1.00
R5939:Slc9c1 UTSW 16 45,368,031 (GRCm39) missense probably benign 0.00
R6110:Slc9c1 UTSW 16 45,395,731 (GRCm39) missense probably damaging 1.00
R6115:Slc9c1 UTSW 16 45,376,132 (GRCm39) missense probably damaging 1.00
R6277:Slc9c1 UTSW 16 45,427,204 (GRCm39) utr 3 prime probably benign
R6286:Slc9c1 UTSW 16 45,398,194 (GRCm39) missense probably benign 0.14
R7268:Slc9c1 UTSW 16 45,370,479 (GRCm39) missense probably damaging 1.00
R7272:Slc9c1 UTSW 16 45,401,878 (GRCm39) missense possibly damaging 0.89
R7431:Slc9c1 UTSW 16 45,413,847 (GRCm39) missense probably damaging 1.00
R7573:Slc9c1 UTSW 16 45,398,256 (GRCm39) missense probably benign 0.00
R7881:Slc9c1 UTSW 16 45,403,332 (GRCm39) missense probably benign 0.00
R8207:Slc9c1 UTSW 16 45,360,076 (GRCm39) missense possibly damaging 0.65
R8289:Slc9c1 UTSW 16 45,403,344 (GRCm39) missense probably benign 0.09
R8302:Slc9c1 UTSW 16 45,368,058 (GRCm39) missense probably benign
R8328:Slc9c1 UTSW 16 45,398,227 (GRCm39) missense probably damaging 0.97
R8421:Slc9c1 UTSW 16 45,413,734 (GRCm39) missense probably damaging 0.97
R8691:Slc9c1 UTSW 16 45,427,182 (GRCm39) missense probably benign 0.00
R8712:Slc9c1 UTSW 16 45,380,646 (GRCm39) missense probably benign 0.00
R9128:Slc9c1 UTSW 16 45,400,490 (GRCm39) missense probably benign 0.25
R9191:Slc9c1 UTSW 16 45,420,144 (GRCm39) missense possibly damaging 0.57
R9230:Slc9c1 UTSW 16 45,398,275 (GRCm39) missense possibly damaging 0.93
R9248:Slc9c1 UTSW 16 45,370,551 (GRCm39) missense probably benign 0.01
R9417:Slc9c1 UTSW 16 45,413,848 (GRCm39) missense probably benign 0.45
R9519:Slc9c1 UTSW 16 45,395,770 (GRCm39) missense probably damaging 1.00
R9570:Slc9c1 UTSW 16 45,380,705 (GRCm39) missense probably benign 0.13
R9686:Slc9c1 UTSW 16 45,400,577 (GRCm39) missense possibly damaging 0.72
R9742:Slc9c1 UTSW 16 45,400,616 (GRCm39) missense probably damaging 1.00
V8831:Slc9c1 UTSW 16 45,398,262 (GRCm39) missense possibly damaging 0.89
Z1176:Slc9c1 UTSW 16 45,378,601 (GRCm39) missense possibly damaging 0.48
Z1177:Slc9c1 UTSW 16 45,393,782 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AATGTGTGTCCTTTGGGAAGAAAAC -3'
(R):5'- ATGTGCAGGTCAAGTCAGC -3'

Sequencing Primer
(F):5'- TCCTTTGGGAAGAAAACTGCTAGAC -3'
(R):5'- GTCAAGTCAGCCTGCCAATACTTG -3'
Posted On 2022-10-06