Incidental Mutation 'R9696:Samd9l'
ID 729280
Institutional Source Beutler Lab
Gene Symbol Samd9l
Ensembl Gene ENSMUSG00000047735
Gene Name sterile alpha motif domain containing 9-like
Synonyms ESTM25
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 3372257-3399571 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 3375078 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 728 (I728F)
Ref Sequence ENSEMBL: ENSMUSP00000112688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000120087
AA Change: I728F

PolyPhen 2 Score 0.762 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: I728F

DomainStartEndE-ValueType
SCOP:d1kw4a_ 8 75 4e-8 SMART
Blast:SAM 11 75 1e-30 BLAST
low complexity region 96 115 N/A INTRINSIC
low complexity region 385 397 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201638
SMART Domains Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

DomainStartEndE-ValueType
Pfam:Ste50p-SAM 10 80 1.2e-8 PFAM
Pfam:SAM_2 11 68 8.7e-6 PFAM
Pfam:SAM_1 12 71 2.5e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,691,256 (GRCm39) D105G possibly damaging Het
4930407I10Rik A G 15: 81,949,697 (GRCm39) N1198S probably benign Het
Abca14 A T 7: 119,888,734 (GRCm39) I1227F possibly damaging Het
Abhd10 T C 16: 45,552,042 (GRCm39) D277G probably damaging Het
Adam20 A G 8: 41,249,633 (GRCm39) N581S probably damaging Het
Apbb1ip A T 2: 22,725,989 (GRCm39) T254S probably benign Het
Arap3 T C 18: 38,112,905 (GRCm39) T1102A probably damaging Het
Asb16 A T 11: 102,159,766 (GRCm39) R40W probably damaging Het
Birc6 T A 17: 74,947,292 (GRCm39) S3019T probably damaging Het
Btbd18 T A 2: 84,497,854 (GRCm39) C497* probably null Het
Cacna1h T C 17: 25,602,215 (GRCm39) M1542V possibly damaging Het
Ccdc8 T G 7: 16,730,087 (GRCm39) S525R unknown Het
Ch25h G A 19: 34,451,947 (GRCm39) R194W probably damaging Het
Ciapin1 C A 8: 95,555,065 (GRCm39) L130F probably damaging Het
Cnfn G T 7: 25,067,515 (GRCm39) T54N probably damaging Het
Cop1 A T 1: 159,076,783 (GRCm39) I195F probably damaging Het
Daam1 A G 12: 71,991,147 (GRCm39) R254G unknown Het
Dcaf13 T C 15: 39,001,496 (GRCm39) M268T possibly damaging Het
Disp3 C A 4: 148,345,611 (GRCm39) V410L probably damaging Het
Dus4l A T 12: 31,696,647 (GRCm39) I110K probably damaging Het
Endov C T 11: 119,398,048 (GRCm39) P271L probably damaging Het
Epha2 A G 4: 141,047,834 (GRCm39) I539V probably benign Het
Ercc4 A T 16: 12,950,810 (GRCm39) I635L probably damaging Het
Exosc10 A G 4: 148,649,704 (GRCm39) D378G probably damaging Het
Fmnl1 A G 11: 103,086,297 (GRCm39) D804G unknown Het
Gm11983 T A 11: 6,787,020 (GRCm39) I36F unknown Het
Gm11992 A T 11: 9,006,438 (GRCm39) I123L probably benign Het
Gm19965 T C 1: 116,730,838 (GRCm39) probably benign Het
Gm19965 A G 1: 116,749,210 (GRCm39) D297G Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Gse1 T C 8: 120,956,280 (GRCm39) V257A unknown Het
Haus1 A T 18: 77,847,202 (GRCm39) S225T probably benign Het
Hgf A G 5: 16,777,534 (GRCm39) Y177C probably damaging Het
Insig1 T C 5: 28,279,546 (GRCm39) W184R probably damaging Het
Krt5 A T 15: 101,616,141 (GRCm39) S491R unknown Het
Lcn5 A G 2: 25,550,142 (GRCm39) I110V probably benign Het
Lin9 A T 1: 180,496,733 (GRCm39) S341C possibly damaging Het
Magi2 C T 5: 20,670,864 (GRCm39) H403Y probably benign Het
Mapk1ip1l C T 14: 47,548,340 (GRCm39) P163S probably damaging Het
Mbtd1 A G 11: 93,823,218 (GRCm39) D568G probably damaging Het
Mdp1 A G 14: 55,896,704 (GRCm39) V119A probably benign Het
Me1 A G 9: 86,469,047 (GRCm39) I506T probably damaging Het
Med1 A G 11: 98,061,772 (GRCm39) probably null Het
Med25 T A 7: 44,529,524 (GRCm39) Q656L probably benign Het
Memo1 A C 17: 74,524,041 (GRCm39) I213S probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mpi T C 9: 57,452,539 (GRCm39) D331G probably benign Het
Muc4 T C 16: 32,574,712 (GRCm39) I1054T probably benign Het
Nat10 T C 2: 103,556,040 (GRCm39) E927G possibly damaging Het
Nlrp9a T C 7: 26,275,033 (GRCm39) L930P unknown Het
Nt5c3b A T 11: 100,323,811 (GRCm39) I167N probably damaging Het
Ogdh T C 11: 6,289,209 (GRCm39) S308P probably damaging Het
Or2y1b A G 11: 49,208,390 (GRCm39) I6V probably benign Het
Or4c108 T G 2: 88,803,615 (GRCm39) I207L probably benign Het
Or52e5 T A 7: 104,719,283 (GRCm39) V203D probably damaging Het
Or8b9 G A 9: 37,766,671 (GRCm39) E186K probably benign Het
Parl A G 16: 20,105,690 (GRCm39) V244A probably benign Het
Parp14 G T 16: 35,661,252 (GRCm39) D1565E probably damaging Het
Parp14 T C 16: 35,661,251 (GRCm39) K1566E possibly damaging Het
Pcdhb18 T A 18: 37,623,606 (GRCm39) I312K possibly damaging Het
Pcnp A T 16: 55,844,867 (GRCm39) probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Rab10 T A 12: 3,306,947 (GRCm39) M83L probably benign Het
Rabep1 A G 11: 70,814,029 (GRCm39) S616G probably benign Het
Rnf213 G A 11: 119,359,806 (GRCm39) V4400M Het
Scaf4 T A 16: 90,044,122 (GRCm39) D620V unknown Het
Scnn1b A T 7: 121,498,462 (GRCm39) M1L probably damaging Het
Sec23b T A 2: 144,428,343 (GRCm39) M652K probably benign Het
Selenoi T C 5: 30,453,413 (GRCm39) F44L probably benign Het
Slc36a3 A T 11: 55,026,161 (GRCm39) V219E possibly damaging Het
Sncaip A T 18: 53,038,915 (GRCm39) Q543L probably damaging Het
Stmnd1 A G 13: 46,443,224 (GRCm39) I119V probably damaging Het
Strn3 T A 12: 51,676,286 (GRCm39) E414D probably damaging Het
Syne1 T A 10: 5,297,847 (GRCm39) H1150L probably benign Het
Tdrd7 A G 4: 46,016,888 (GRCm39) N676S possibly damaging Het
Tgs1 A T 4: 3,575,071 (GRCm39) I16F possibly damaging Het
Thnsl2 T G 6: 71,108,930 (GRCm39) T294P possibly damaging Het
Tmem156 A G 5: 65,231,147 (GRCm39) I241T possibly damaging Het
Unc13a A T 8: 72,082,197 (GRCm39) M1689K possibly damaging Het
Uri1 T C 7: 37,664,738 (GRCm39) D318G probably benign Het
Vmn2r86 T A 10: 130,285,702 (GRCm39) Q491L possibly damaging Het
Vps13b C A 15: 35,675,033 (GRCm39) Q1718K possibly damaging Het
Other mutations in Samd9l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Samd9l APN 6 3,376,779 (GRCm39) missense probably damaging 0.96
IGL00550:Samd9l APN 6 3,374,594 (GRCm39) missense probably benign 0.00
IGL01100:Samd9l APN 6 3,375,863 (GRCm39) missense possibly damaging 0.91
IGL01321:Samd9l APN 6 3,376,259 (GRCm39) missense probably benign 0.42
IGL01553:Samd9l APN 6 3,375,566 (GRCm39) missense probably damaging 0.99
IGL01575:Samd9l APN 6 3,376,734 (GRCm39) missense possibly damaging 0.85
IGL01896:Samd9l APN 6 3,375,120 (GRCm39) missense probably benign 0.02
IGL01915:Samd9l APN 6 3,373,864 (GRCm39) nonsense probably null
IGL02063:Samd9l APN 6 3,372,992 (GRCm39) missense probably damaging 1.00
IGL02066:Samd9l APN 6 3,376,575 (GRCm39) missense probably damaging 1.00
IGL02145:Samd9l APN 6 3,374,105 (GRCm39) missense probably benign 0.13
IGL02163:Samd9l APN 6 3,374,246 (GRCm39) missense possibly damaging 0.90
IGL02256:Samd9l APN 6 3,376,197 (GRCm39) missense probably damaging 1.00
IGL02508:Samd9l APN 6 3,374,798 (GRCm39) missense probably damaging 1.00
IGL02591:Samd9l APN 6 3,375,760 (GRCm39) missense possibly damaging 0.91
IGL02968:Samd9l APN 6 3,376,026 (GRCm39) missense probably damaging 1.00
IGL03058:Samd9l APN 6 3,374,980 (GRCm39) missense probably damaging 0.99
IGL03068:Samd9l APN 6 3,375,348 (GRCm39) nonsense probably null
IGL03160:Samd9l APN 6 3,374,894 (GRCm39) missense probably damaging 1.00
IGL03372:Samd9l APN 6 3,375,314 (GRCm39) missense probably damaging 1.00
IGL03385:Samd9l APN 6 3,376,208 (GRCm39) missense probably damaging 0.99
boston_lager UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
ipa UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
Paine UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
samad UTSW 6 3,374,032 (GRCm39) nonsense probably null
IGL03054:Samd9l UTSW 6 3,376,023 (GRCm39) missense probably damaging 1.00
R0111:Samd9l UTSW 6 3,374,946 (GRCm39) missense possibly damaging 0.80
R0112:Samd9l UTSW 6 3,376,031 (GRCm39) missense possibly damaging 0.93
R0356:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R0370:Samd9l UTSW 6 3,377,264 (GRCm39) start gained probably benign
R0398:Samd9l UTSW 6 3,374,502 (GRCm39) missense probably damaging 1.00
R0744:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0833:Samd9l UTSW 6 3,372,725 (GRCm39) missense possibly damaging 0.92
R0880:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R1110:Samd9l UTSW 6 3,374,267 (GRCm39) missense probably benign 0.44
R1155:Samd9l UTSW 6 3,376,939 (GRCm39) missense probably benign 0.01
R1268:Samd9l UTSW 6 3,376,113 (GRCm39) missense possibly damaging 0.56
R1293:Samd9l UTSW 6 3,373,947 (GRCm39) missense possibly damaging 0.93
R1478:Samd9l UTSW 6 3,376,369 (GRCm39) missense probably benign 0.06
R1573:Samd9l UTSW 6 3,375,426 (GRCm39) missense probably damaging 0.99
R1590:Samd9l UTSW 6 3,375,761 (GRCm39) missense probably benign 0.12
R1611:Samd9l UTSW 6 3,373,771 (GRCm39) missense probably benign 0.00
R1754:Samd9l UTSW 6 3,373,126 (GRCm39) missense probably damaging 0.96
R1759:Samd9l UTSW 6 3,373,401 (GRCm39) missense probably damaging 1.00
R1795:Samd9l UTSW 6 3,375,264 (GRCm39) nonsense probably null
R1829:Samd9l UTSW 6 3,375,107 (GRCm39) missense possibly damaging 0.69
R1935:Samd9l UTSW 6 3,376,269 (GRCm39) missense probably benign 0.01
R2154:Samd9l UTSW 6 3,372,945 (GRCm39) missense possibly damaging 0.91
R2228:Samd9l UTSW 6 3,376,910 (GRCm39) missense probably benign 0.08
R3622:Samd9l UTSW 6 3,374,032 (GRCm39) nonsense probably null
R3903:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3904:Samd9l UTSW 6 3,376,830 (GRCm39) nonsense probably null
R3945:Samd9l UTSW 6 3,377,029 (GRCm39) missense possibly damaging 0.71
R4091:Samd9l UTSW 6 3,376,887 (GRCm39) missense probably benign 0.22
R4602:Samd9l UTSW 6 3,373,937 (GRCm39) frame shift probably null
R4602:Samd9l UTSW 6 3,373,935 (GRCm39) missense probably damaging 1.00
R4618:Samd9l UTSW 6 3,376,347 (GRCm39) missense probably damaging 1.00
R4747:Samd9l UTSW 6 3,375,504 (GRCm39) nonsense probably null
R4762:Samd9l UTSW 6 3,375,623 (GRCm39) missense probably benign 0.01
R4814:Samd9l UTSW 6 3,372,863 (GRCm39) missense probably damaging 0.98
R4934:Samd9l UTSW 6 3,375,621 (GRCm39) nonsense probably null
R5026:Samd9l UTSW 6 3,375,284 (GRCm39) missense possibly damaging 0.75
R5048:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R5130:Samd9l UTSW 6 3,374,548 (GRCm39) missense possibly damaging 0.69
R5271:Samd9l UTSW 6 3,376,156 (GRCm39) missense probably benign 0.02
R5328:Samd9l UTSW 6 3,376,739 (GRCm39) missense probably damaging 0.99
R5507:Samd9l UTSW 6 3,373,898 (GRCm39) missense possibly damaging 0.78
R5587:Samd9l UTSW 6 3,373,291 (GRCm39) missense possibly damaging 0.84
R5846:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R5881:Samd9l UTSW 6 3,372,716 (GRCm39) missense possibly damaging 0.70
R5889:Samd9l UTSW 6 3,376,460 (GRCm39) missense probably damaging 1.00
R6131:Samd9l UTSW 6 3,377,252 (GRCm39) missense probably benign 0.00
R6199:Samd9l UTSW 6 3,376,686 (GRCm39) missense probably benign 0.13
R6298:Samd9l UTSW 6 3,375,383 (GRCm39) missense probably damaging 1.00
R6331:Samd9l UTSW 6 3,376,361 (GRCm39) missense probably damaging 1.00
R6489:Samd9l UTSW 6 3,376,896 (GRCm39) missense probably benign
R6601:Samd9l UTSW 6 3,377,229 (GRCm39) missense possibly damaging 0.74
R6655:Samd9l UTSW 6 3,377,247 (GRCm39) missense probably benign 0.22
R6803:Samd9l UTSW 6 3,375,446 (GRCm39) missense probably damaging 0.97
R6864:Samd9l UTSW 6 3,374,750 (GRCm39) missense probably benign 0.14
R6905:Samd9l UTSW 6 3,375,387 (GRCm39) missense probably damaging 0.99
R6919:Samd9l UTSW 6 3,376,313 (GRCm39) missense possibly damaging 0.88
R7060:Samd9l UTSW 6 3,372,716 (GRCm39) missense probably damaging 0.99
R7073:Samd9l UTSW 6 3,375,856 (GRCm39) nonsense probably null
R7250:Samd9l UTSW 6 3,374,201 (GRCm39) missense possibly damaging 0.78
R7307:Samd9l UTSW 6 3,372,600 (GRCm39) nonsense probably null
R7351:Samd9l UTSW 6 3,374,157 (GRCm39) missense probably benign 0.35
R7423:Samd9l UTSW 6 3,374,408 (GRCm39) missense probably damaging 1.00
R7610:Samd9l UTSW 6 3,376,754 (GRCm39) missense probably benign
R7667:Samd9l UTSW 6 3,375,975 (GRCm39) missense possibly damaging 0.87
R7672:Samd9l UTSW 6 3,373,646 (GRCm39) missense probably benign 0.16
R7680:Samd9l UTSW 6 3,376,469 (GRCm39) missense probably damaging 1.00
R7680:Samd9l UTSW 6 3,372,569 (GRCm39) missense probably damaging 1.00
R7814:Samd9l UTSW 6 3,374,793 (GRCm39) missense possibly damaging 0.86
R7829:Samd9l UTSW 6 3,374,749 (GRCm39) missense probably benign 0.00
R8000:Samd9l UTSW 6 3,373,034 (GRCm39) missense probably damaging 1.00
R8098:Samd9l UTSW 6 3,375,549 (GRCm39) missense probably damaging 1.00
R8698:Samd9l UTSW 6 3,373,843 (GRCm39) missense probably benign 0.06
R8785:Samd9l UTSW 6 3,377,064 (GRCm39) missense probably damaging 0.99
R8795:Samd9l UTSW 6 3,374,221 (GRCm39) nonsense probably null
R8806:Samd9l UTSW 6 3,376,665 (GRCm39) missense probably damaging 0.99
R8832:Samd9l UTSW 6 3,374,990 (GRCm39) missense probably damaging 1.00
R8954:Samd9l UTSW 6 3,374,577 (GRCm39) missense probably damaging 0.98
R9023:Samd9l UTSW 6 3,373,791 (GRCm39) missense probably damaging 1.00
R9051:Samd9l UTSW 6 3,373,493 (GRCm39) missense probably benign 0.16
R9108:Samd9l UTSW 6 3,373,104 (GRCm39) missense possibly damaging 0.71
R9213:Samd9l UTSW 6 3,376,856 (GRCm39) missense probably benign 0.23
R9494:Samd9l UTSW 6 3,375,830 (GRCm39) missense possibly damaging 0.51
R9504:Samd9l UTSW 6 3,372,621 (GRCm39) missense probably benign 0.17
R9655:Samd9l UTSW 6 3,373,578 (GRCm39) missense probably benign 0.00
R9688:Samd9l UTSW 6 3,377,087 (GRCm39) missense probably damaging 1.00
R9721:Samd9l UTSW 6 3,375,854 (GRCm39) missense possibly damaging 0.69
X0026:Samd9l UTSW 6 3,375,560 (GRCm39) missense probably damaging 1.00
X0066:Samd9l UTSW 6 3,374,477 (GRCm39) missense probably damaging 1.00
Z1176:Samd9l UTSW 6 3,376,770 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGAAGTCCTCGTGGCTG -3'
(R):5'- CCTCTGTGAAAATGAGTGTAAAGAC -3'

Sequencing Primer
(F):5'- AAGTCCTCGTGGCTGGTAGC -3'
(R):5'- CACAGACATAGAGAAAGATGAATCTC -3'
Posted On 2022-10-06