Incidental Mutation 'R9696:Ccdc8'
ID 729283
Institutional Source Beutler Lab
Gene Symbol Ccdc8
Ensembl Gene ENSMUSG00000041117
Gene Name coiled-coil domain containing 8
Synonyms ENSMUSG00000041117
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 16727827-16731440 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 16730087 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 525 (S525R)
Ref Sequence ENSEMBL: ENSMUSP00000092399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094805]
AlphaFold D3YZV8
Predicted Effect unknown
Transcript: ENSMUST00000094805
AA Change: S525R
SMART Domains Protein: ENSMUSP00000092399
Gene: ENSMUSG00000041117
AA Change: S525R

DomainStartEndE-ValueType
Pfam:PNMA 1 98 1.3e-19 PFAM
low complexity region 166 171 N/A INTRINSIC
internal_repeat_1 207 275 5.53e-5 PROSPERO
low complexity region 297 332 N/A INTRINSIC
low complexity region 335 420 N/A INTRINSIC
low complexity region 430 452 N/A INTRINSIC
low complexity region 458 468 N/A INTRINSIC
low complexity region 478 540 N/A INTRINSIC
internal_repeat_1 566 640 5.53e-5 PROSPERO
low complexity region 646 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein. The encoded protein functions as a cofactor required for p53-mediated apoptosis following DNA damage, and may also play a role in growth through interactions with the cytoskeletal adaptor protein obscurin-like 1. Mutations in this gene are a cause of 3M syndrome-3 (3M3). [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,691,256 (GRCm39) D105G possibly damaging Het
4930407I10Rik A G 15: 81,949,697 (GRCm39) N1198S probably benign Het
Abca14 A T 7: 119,888,734 (GRCm39) I1227F possibly damaging Het
Abhd10 T C 16: 45,552,042 (GRCm39) D277G probably damaging Het
Adam20 A G 8: 41,249,633 (GRCm39) N581S probably damaging Het
Apbb1ip A T 2: 22,725,989 (GRCm39) T254S probably benign Het
Arap3 T C 18: 38,112,905 (GRCm39) T1102A probably damaging Het
Asb16 A T 11: 102,159,766 (GRCm39) R40W probably damaging Het
Birc6 T A 17: 74,947,292 (GRCm39) S3019T probably damaging Het
Btbd18 T A 2: 84,497,854 (GRCm39) C497* probably null Het
Cacna1h T C 17: 25,602,215 (GRCm39) M1542V possibly damaging Het
Ch25h G A 19: 34,451,947 (GRCm39) R194W probably damaging Het
Ciapin1 C A 8: 95,555,065 (GRCm39) L130F probably damaging Het
Cnfn G T 7: 25,067,515 (GRCm39) T54N probably damaging Het
Cop1 A T 1: 159,076,783 (GRCm39) I195F probably damaging Het
Daam1 A G 12: 71,991,147 (GRCm39) R254G unknown Het
Dcaf13 T C 15: 39,001,496 (GRCm39) M268T possibly damaging Het
Disp3 C A 4: 148,345,611 (GRCm39) V410L probably damaging Het
Dus4l A T 12: 31,696,647 (GRCm39) I110K probably damaging Het
Endov C T 11: 119,398,048 (GRCm39) P271L probably damaging Het
Epha2 A G 4: 141,047,834 (GRCm39) I539V probably benign Het
Ercc4 A T 16: 12,950,810 (GRCm39) I635L probably damaging Het
Exosc10 A G 4: 148,649,704 (GRCm39) D378G probably damaging Het
Fmnl1 A G 11: 103,086,297 (GRCm39) D804G unknown Het
Gm11983 T A 11: 6,787,020 (GRCm39) I36F unknown Het
Gm11992 A T 11: 9,006,438 (GRCm39) I123L probably benign Het
Gm19965 T C 1: 116,730,838 (GRCm39) probably benign Het
Gm19965 A G 1: 116,749,210 (GRCm39) D297G Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Gse1 T C 8: 120,956,280 (GRCm39) V257A unknown Het
Haus1 A T 18: 77,847,202 (GRCm39) S225T probably benign Het
Hgf A G 5: 16,777,534 (GRCm39) Y177C probably damaging Het
Insig1 T C 5: 28,279,546 (GRCm39) W184R probably damaging Het
Krt5 A T 15: 101,616,141 (GRCm39) S491R unknown Het
Lcn5 A G 2: 25,550,142 (GRCm39) I110V probably benign Het
Lin9 A T 1: 180,496,733 (GRCm39) S341C possibly damaging Het
Magi2 C T 5: 20,670,864 (GRCm39) H403Y probably benign Het
Mapk1ip1l C T 14: 47,548,340 (GRCm39) P163S probably damaging Het
Mbtd1 A G 11: 93,823,218 (GRCm39) D568G probably damaging Het
Mdp1 A G 14: 55,896,704 (GRCm39) V119A probably benign Het
Me1 A G 9: 86,469,047 (GRCm39) I506T probably damaging Het
Med1 A G 11: 98,061,772 (GRCm39) probably null Het
Med25 T A 7: 44,529,524 (GRCm39) Q656L probably benign Het
Memo1 A C 17: 74,524,041 (GRCm39) I213S probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mpi T C 9: 57,452,539 (GRCm39) D331G probably benign Het
Muc4 T C 16: 32,574,712 (GRCm39) I1054T probably benign Het
Nat10 T C 2: 103,556,040 (GRCm39) E927G possibly damaging Het
Nlrp9a T C 7: 26,275,033 (GRCm39) L930P unknown Het
Nt5c3b A T 11: 100,323,811 (GRCm39) I167N probably damaging Het
Ogdh T C 11: 6,289,209 (GRCm39) S308P probably damaging Het
Or2y1b A G 11: 49,208,390 (GRCm39) I6V probably benign Het
Or4c108 T G 2: 88,803,615 (GRCm39) I207L probably benign Het
Or52e5 T A 7: 104,719,283 (GRCm39) V203D probably damaging Het
Or8b9 G A 9: 37,766,671 (GRCm39) E186K probably benign Het
Parl A G 16: 20,105,690 (GRCm39) V244A probably benign Het
Parp14 G T 16: 35,661,252 (GRCm39) D1565E probably damaging Het
Parp14 T C 16: 35,661,251 (GRCm39) K1566E possibly damaging Het
Pcdhb18 T A 18: 37,623,606 (GRCm39) I312K possibly damaging Het
Pcnp A T 16: 55,844,867 (GRCm39) probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Rab10 T A 12: 3,306,947 (GRCm39) M83L probably benign Het
Rabep1 A G 11: 70,814,029 (GRCm39) S616G probably benign Het
Rnf213 G A 11: 119,359,806 (GRCm39) V4400M Het
Samd9l T A 6: 3,375,078 (GRCm39) I728F possibly damaging Het
Scaf4 T A 16: 90,044,122 (GRCm39) D620V unknown Het
Scnn1b A T 7: 121,498,462 (GRCm39) M1L probably damaging Het
Sec23b T A 2: 144,428,343 (GRCm39) M652K probably benign Het
Selenoi T C 5: 30,453,413 (GRCm39) F44L probably benign Het
Slc36a3 A T 11: 55,026,161 (GRCm39) V219E possibly damaging Het
Sncaip A T 18: 53,038,915 (GRCm39) Q543L probably damaging Het
Stmnd1 A G 13: 46,443,224 (GRCm39) I119V probably damaging Het
Strn3 T A 12: 51,676,286 (GRCm39) E414D probably damaging Het
Syne1 T A 10: 5,297,847 (GRCm39) H1150L probably benign Het
Tdrd7 A G 4: 46,016,888 (GRCm39) N676S possibly damaging Het
Tgs1 A T 4: 3,575,071 (GRCm39) I16F possibly damaging Het
Thnsl2 T G 6: 71,108,930 (GRCm39) T294P possibly damaging Het
Tmem156 A G 5: 65,231,147 (GRCm39) I241T possibly damaging Het
Unc13a A T 8: 72,082,197 (GRCm39) M1689K possibly damaging Het
Uri1 T C 7: 37,664,738 (GRCm39) D318G probably benign Het
Vmn2r86 T A 10: 130,285,702 (GRCm39) Q491L possibly damaging Het
Vps13b C A 15: 35,675,033 (GRCm39) Q1718K possibly damaging Het
Other mutations in Ccdc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Ccdc8 APN 7 16,729,967 (GRCm39) missense unknown
R0255:Ccdc8 UTSW 7 16,729,582 (GRCm39) missense unknown
R0504:Ccdc8 UTSW 7 16,729,939 (GRCm39) missense unknown
R3843:Ccdc8 UTSW 7 16,729,039 (GRCm39) missense probably damaging 1.00
R5054:Ccdc8 UTSW 7 16,728,970 (GRCm39) missense probably damaging 1.00
R6020:Ccdc8 UTSW 7 16,730,506 (GRCm39) missense probably damaging 0.99
R6045:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R6244:Ccdc8 UTSW 7 16,730,176 (GRCm39) missense probably benign 0.04
R6753:Ccdc8 UTSW 7 16,730,562 (GRCm39) nonsense probably null
R7299:Ccdc8 UTSW 7 16,729,956 (GRCm39) missense unknown
R7567:Ccdc8 UTSW 7 16,728,687 (GRCm39) missense probably damaging 1.00
R7623:Ccdc8 UTSW 7 16,730,537 (GRCm39) missense possibly damaging 0.70
R7745:Ccdc8 UTSW 7 16,729,614 (GRCm39) missense unknown
R8310:Ccdc8 UTSW 7 16,729,326 (GRCm39) missense probably damaging 1.00
R8707:Ccdc8 UTSW 7 16,729,975 (GRCm39) missense unknown
R8840:Ccdc8 UTSW 7 16,728,642 (GRCm39) missense probably damaging 1.00
R9099:Ccdc8 UTSW 7 16,728,800 (GRCm39) nonsense probably null
R9630:Ccdc8 UTSW 7 16,728,733 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TAACCAGAAGGCAGAGCTTG -3'
(R):5'- TCCTGTATACCCTGAGGTCCTG -3'

Sequencing Primer
(F):5'- GCTTGTAGATAGTCCAAGGGC -3'
(R):5'- TGCCCTTTGGTCAGCTAGGAC -3'
Posted On 2022-10-06