Incidental Mutation 'R9696:Abca14'
ID 729289
Institutional Source Beutler Lab
Gene Symbol Abca14
Ensembl Gene ENSMUSG00000062017
Gene Name ATP-binding cassette, sub-family A member 14
Synonyms 1700110B15Rik, 4930539G24Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9696 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 119803184-119924575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 119888734 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1227 (I1227F)
Ref Sequence ENSEMBL: ENSMUSP00000081690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084640]
AlphaFold E9Q8F8
Predicted Effect possibly damaging
Transcript: ENSMUST00000084640
AA Change: I1227F

PolyPhen 2 Score 0.587 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081690
Gene: ENSMUSG00000062017
AA Change: I1227F

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 463 5.7e-23 PFAM
AAA 548 729 1.59e-10 SMART
Pfam:ABC2_membrane_3 902 1296 1.2e-36 PFAM
AAA 1384 1568 1.33e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001O22Rik T C 2: 30,691,256 (GRCm39) D105G possibly damaging Het
4930407I10Rik A G 15: 81,949,697 (GRCm39) N1198S probably benign Het
Abhd10 T C 16: 45,552,042 (GRCm39) D277G probably damaging Het
Adam20 A G 8: 41,249,633 (GRCm39) N581S probably damaging Het
Apbb1ip A T 2: 22,725,989 (GRCm39) T254S probably benign Het
Arap3 T C 18: 38,112,905 (GRCm39) T1102A probably damaging Het
Asb16 A T 11: 102,159,766 (GRCm39) R40W probably damaging Het
Birc6 T A 17: 74,947,292 (GRCm39) S3019T probably damaging Het
Btbd18 T A 2: 84,497,854 (GRCm39) C497* probably null Het
Cacna1h T C 17: 25,602,215 (GRCm39) M1542V possibly damaging Het
Ccdc8 T G 7: 16,730,087 (GRCm39) S525R unknown Het
Ch25h G A 19: 34,451,947 (GRCm39) R194W probably damaging Het
Ciapin1 C A 8: 95,555,065 (GRCm39) L130F probably damaging Het
Cnfn G T 7: 25,067,515 (GRCm39) T54N probably damaging Het
Cop1 A T 1: 159,076,783 (GRCm39) I195F probably damaging Het
Daam1 A G 12: 71,991,147 (GRCm39) R254G unknown Het
Dcaf13 T C 15: 39,001,496 (GRCm39) M268T possibly damaging Het
Disp3 C A 4: 148,345,611 (GRCm39) V410L probably damaging Het
Dus4l A T 12: 31,696,647 (GRCm39) I110K probably damaging Het
Endov C T 11: 119,398,048 (GRCm39) P271L probably damaging Het
Epha2 A G 4: 141,047,834 (GRCm39) I539V probably benign Het
Ercc4 A T 16: 12,950,810 (GRCm39) I635L probably damaging Het
Exosc10 A G 4: 148,649,704 (GRCm39) D378G probably damaging Het
Fmnl1 A G 11: 103,086,297 (GRCm39) D804G unknown Het
Gm11983 T A 11: 6,787,020 (GRCm39) I36F unknown Het
Gm11992 A T 11: 9,006,438 (GRCm39) I123L probably benign Het
Gm19965 T C 1: 116,730,838 (GRCm39) probably benign Het
Gm19965 A G 1: 116,749,210 (GRCm39) D297G Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Gse1 T C 8: 120,956,280 (GRCm39) V257A unknown Het
Haus1 A T 18: 77,847,202 (GRCm39) S225T probably benign Het
Hgf A G 5: 16,777,534 (GRCm39) Y177C probably damaging Het
Insig1 T C 5: 28,279,546 (GRCm39) W184R probably damaging Het
Krt5 A T 15: 101,616,141 (GRCm39) S491R unknown Het
Lcn5 A G 2: 25,550,142 (GRCm39) I110V probably benign Het
Lin9 A T 1: 180,496,733 (GRCm39) S341C possibly damaging Het
Magi2 C T 5: 20,670,864 (GRCm39) H403Y probably benign Het
Mapk1ip1l C T 14: 47,548,340 (GRCm39) P163S probably damaging Het
Mbtd1 A G 11: 93,823,218 (GRCm39) D568G probably damaging Het
Mdp1 A G 14: 55,896,704 (GRCm39) V119A probably benign Het
Me1 A G 9: 86,469,047 (GRCm39) I506T probably damaging Het
Med1 A G 11: 98,061,772 (GRCm39) probably null Het
Med25 T A 7: 44,529,524 (GRCm39) Q656L probably benign Het
Memo1 A C 17: 74,524,041 (GRCm39) I213S probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mpi T C 9: 57,452,539 (GRCm39) D331G probably benign Het
Muc4 T C 16: 32,574,712 (GRCm39) I1054T probably benign Het
Nat10 T C 2: 103,556,040 (GRCm39) E927G possibly damaging Het
Nlrp9a T C 7: 26,275,033 (GRCm39) L930P unknown Het
Nt5c3b A T 11: 100,323,811 (GRCm39) I167N probably damaging Het
Ogdh T C 11: 6,289,209 (GRCm39) S308P probably damaging Het
Or2y1b A G 11: 49,208,390 (GRCm39) I6V probably benign Het
Or4c108 T G 2: 88,803,615 (GRCm39) I207L probably benign Het
Or52e5 T A 7: 104,719,283 (GRCm39) V203D probably damaging Het
Or8b9 G A 9: 37,766,671 (GRCm39) E186K probably benign Het
Parl A G 16: 20,105,690 (GRCm39) V244A probably benign Het
Parp14 G T 16: 35,661,252 (GRCm39) D1565E probably damaging Het
Parp14 T C 16: 35,661,251 (GRCm39) K1566E possibly damaging Het
Pcdhb18 T A 18: 37,623,606 (GRCm39) I312K possibly damaging Het
Pcnp A T 16: 55,844,867 (GRCm39) probably benign Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 (GRCm39) probably benign Het
Rab10 T A 12: 3,306,947 (GRCm39) M83L probably benign Het
Rabep1 A G 11: 70,814,029 (GRCm39) S616G probably benign Het
Rnf213 G A 11: 119,359,806 (GRCm39) V4400M Het
Samd9l T A 6: 3,375,078 (GRCm39) I728F possibly damaging Het
Scaf4 T A 16: 90,044,122 (GRCm39) D620V unknown Het
Scnn1b A T 7: 121,498,462 (GRCm39) M1L probably damaging Het
Sec23b T A 2: 144,428,343 (GRCm39) M652K probably benign Het
Selenoi T C 5: 30,453,413 (GRCm39) F44L probably benign Het
Slc36a3 A T 11: 55,026,161 (GRCm39) V219E possibly damaging Het
Sncaip A T 18: 53,038,915 (GRCm39) Q543L probably damaging Het
Stmnd1 A G 13: 46,443,224 (GRCm39) I119V probably damaging Het
Strn3 T A 12: 51,676,286 (GRCm39) E414D probably damaging Het
Syne1 T A 10: 5,297,847 (GRCm39) H1150L probably benign Het
Tdrd7 A G 4: 46,016,888 (GRCm39) N676S possibly damaging Het
Tgs1 A T 4: 3,575,071 (GRCm39) I16F possibly damaging Het
Thnsl2 T G 6: 71,108,930 (GRCm39) T294P possibly damaging Het
Tmem156 A G 5: 65,231,147 (GRCm39) I241T possibly damaging Het
Unc13a A T 8: 72,082,197 (GRCm39) M1689K possibly damaging Het
Uri1 T C 7: 37,664,738 (GRCm39) D318G probably benign Het
Vmn2r86 T A 10: 130,285,702 (GRCm39) Q491L possibly damaging Het
Vps13b C A 15: 35,675,033 (GRCm39) Q1718K possibly damaging Het
Other mutations in Abca14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Abca14 APN 7 119,846,076 (GRCm39) missense probably damaging 1.00
IGL00800:Abca14 APN 7 119,854,613 (GRCm39) missense probably benign 0.01
IGL00845:Abca14 APN 7 119,823,174 (GRCm39) splice site probably benign
IGL00897:Abca14 APN 7 119,815,348 (GRCm39) splice site probably benign
IGL01524:Abca14 APN 7 119,852,644 (GRCm39) missense possibly damaging 0.57
IGL01747:Abca14 APN 7 119,877,310 (GRCm39) missense probably benign 0.00
IGL02214:Abca14 APN 7 119,893,398 (GRCm39) missense probably benign 0.09
IGL02215:Abca14 APN 7 119,852,612 (GRCm39) missense probably benign 0.00
IGL02253:Abca14 APN 7 119,807,182 (GRCm39) missense probably benign 0.29
IGL02302:Abca14 APN 7 119,917,968 (GRCm39) splice site probably benign
IGL03391:Abca14 APN 7 119,846,107 (GRCm39) missense probably damaging 1.00
F6893:Abca14 UTSW 7 119,924,261 (GRCm39) missense probably damaging 0.98
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0109:Abca14 UTSW 7 119,917,985 (GRCm39) nonsense probably null
R0265:Abca14 UTSW 7 119,822,850 (GRCm39) missense probably benign 0.03
R0326:Abca14 UTSW 7 119,823,642 (GRCm39) missense probably damaging 1.00
R0380:Abca14 UTSW 7 119,877,703 (GRCm39) missense probably benign 0.03
R0418:Abca14 UTSW 7 119,806,657 (GRCm39) missense probably damaging 1.00
R0539:Abca14 UTSW 7 119,807,020 (GRCm39) missense probably damaging 1.00
R0574:Abca14 UTSW 7 119,823,720 (GRCm39) missense probably damaging 0.96
R0611:Abca14 UTSW 7 119,851,479 (GRCm39) missense possibly damaging 0.63
R0783:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0785:Abca14 UTSW 7 119,893,380 (GRCm39) missense probably damaging 1.00
R0863:Abca14 UTSW 7 119,815,453 (GRCm39) missense probably benign 0.03
R1034:Abca14 UTSW 7 119,815,370 (GRCm39) missense probably damaging 1.00
R1056:Abca14 UTSW 7 119,924,295 (GRCm39) missense probably damaging 1.00
R1072:Abca14 UTSW 7 119,811,992 (GRCm39) missense probably benign
R1244:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1255:Abca14 UTSW 7 119,807,016 (GRCm39) missense probably damaging 0.97
R1271:Abca14 UTSW 7 119,924,340 (GRCm39) missense probably damaging 1.00
R1325:Abca14 UTSW 7 119,846,545 (GRCm39) missense probably benign 0.32
R1457:Abca14 UTSW 7 119,888,683 (GRCm39) missense probably benign 0.00
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1467:Abca14 UTSW 7 119,815,405 (GRCm39) missense possibly damaging 0.80
R1494:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R1551:Abca14 UTSW 7 119,918,101 (GRCm39) missense probably benign 0.10
R1607:Abca14 UTSW 7 119,850,514 (GRCm39) missense probably damaging 1.00
R1739:Abca14 UTSW 7 119,877,529 (GRCm39) missense probably benign 0.04
R1856:Abca14 UTSW 7 119,877,404 (GRCm39) missense probably damaging 1.00
R1875:Abca14 UTSW 7 119,847,190 (GRCm39) missense possibly damaging 0.78
R1892:Abca14 UTSW 7 119,815,561 (GRCm39) missense probably benign 0.06
R1898:Abca14 UTSW 7 119,850,392 (GRCm39) missense probably damaging 1.00
R1958:Abca14 UTSW 7 119,924,382 (GRCm39) missense probably damaging 0.98
R2018:Abca14 UTSW 7 119,815,408 (GRCm39) missense probably benign 0.00
R2039:Abca14 UTSW 7 119,911,487 (GRCm39) missense probably damaging 0.98
R2060:Abca14 UTSW 7 119,826,741 (GRCm39) nonsense probably null
R2202:Abca14 UTSW 7 119,888,764 (GRCm39) missense probably benign 0.17
R2205:Abca14 UTSW 7 119,846,503 (GRCm39) missense probably damaging 0.98
R2360:Abca14 UTSW 7 119,850,431 (GRCm39) missense probably benign 0.00
R2401:Abca14 UTSW 7 119,882,312 (GRCm39) missense probably damaging 1.00
R2426:Abca14 UTSW 7 119,882,446 (GRCm39) missense probably benign 0.04
R3433:Abca14 UTSW 7 119,893,455 (GRCm39) missense probably damaging 0.97
R4598:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4599:Abca14 UTSW 7 119,854,626 (GRCm39) missense probably benign 0.11
R4700:Abca14 UTSW 7 119,911,928 (GRCm39) critical splice donor site probably null
R4751:Abca14 UTSW 7 119,911,400 (GRCm39) missense probably benign 0.01
R4826:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4828:Abca14 UTSW 7 119,815,470 (GRCm39) missense probably damaging 1.00
R4837:Abca14 UTSW 7 119,846,203 (GRCm39) missense probably benign
R4881:Abca14 UTSW 7 119,877,472 (GRCm39) missense possibly damaging 0.49
R4895:Abca14 UTSW 7 119,846,572 (GRCm39) critical splice donor site probably null
R4928:Abca14 UTSW 7 119,923,803 (GRCm39) missense possibly damaging 0.90
R4990:Abca14 UTSW 7 119,911,388 (GRCm39) missense probably benign 0.00
R5027:Abca14 UTSW 7 119,911,505 (GRCm39) missense probably benign 0.05
R5091:Abca14 UTSW 7 119,851,497 (GRCm39) missense probably damaging 1.00
R5158:Abca14 UTSW 7 119,852,652 (GRCm39) missense probably benign
R5209:Abca14 UTSW 7 119,832,130 (GRCm39) missense probably benign 0.01
R5333:Abca14 UTSW 7 119,888,769 (GRCm39) nonsense probably null
R5424:Abca14 UTSW 7 119,810,777 (GRCm39) missense probably benign 0.01
R5488:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5489:Abca14 UTSW 7 119,851,473 (GRCm39) missense probably damaging 0.98
R5716:Abca14 UTSW 7 119,846,217 (GRCm39) critical splice donor site probably null
R6450:Abca14 UTSW 7 119,815,449 (GRCm39) missense probably benign 0.17
R6477:Abca14 UTSW 7 119,924,325 (GRCm39) missense probably benign 0.44
R6652:Abca14 UTSW 7 119,846,164 (GRCm39) missense probably damaging 1.00
R6782:Abca14 UTSW 7 119,847,308 (GRCm39) missense probably damaging 1.00
R6874:Abca14 UTSW 7 119,851,428 (GRCm39) missense possibly damaging 0.71
R6965:Abca14 UTSW 7 119,882,452 (GRCm39) nonsense probably null
R7142:Abca14 UTSW 7 119,850,406 (GRCm39) missense possibly damaging 0.89
R7146:Abca14 UTSW 7 119,854,520 (GRCm39) missense probably benign 0.15
R7202:Abca14 UTSW 7 119,917,236 (GRCm39) missense probably damaging 1.00
R7220:Abca14 UTSW 7 119,826,667 (GRCm39) missense possibly damaging 0.45
R7241:Abca14 UTSW 7 119,846,184 (GRCm39) missense probably damaging 1.00
R7291:Abca14 UTSW 7 119,888,832 (GRCm39) nonsense probably null
R7296:Abca14 UTSW 7 119,877,534 (GRCm39) missense probably benign
R7298:Abca14 UTSW 7 119,807,106 (GRCm39) missense probably benign 0.00
R7315:Abca14 UTSW 7 119,893,341 (GRCm39) missense probably benign 0.00
R7776:Abca14 UTSW 7 119,832,214 (GRCm39) critical splice donor site probably null
R7820:Abca14 UTSW 7 119,811,944 (GRCm39) missense probably benign 0.42
R7873:Abca14 UTSW 7 119,888,792 (GRCm39) missense probably benign 0.17
R8215:Abca14 UTSW 7 119,893,425 (GRCm39) missense probably benign
R8332:Abca14 UTSW 7 119,815,436 (GRCm39) missense probably benign
R8419:Abca14 UTSW 7 119,815,489 (GRCm39) missense probably benign 0.08
R8444:Abca14 UTSW 7 119,918,133 (GRCm39) missense probably damaging 1.00
R8818:Abca14 UTSW 7 119,815,524 (GRCm39) missense probably benign 0.00
R8834:Abca14 UTSW 7 119,877,372 (GRCm39) missense probably benign 0.02
R8845:Abca14 UTSW 7 119,846,428 (GRCm39) missense probably benign 0.00
R8889:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8892:Abca14 UTSW 7 119,815,606 (GRCm39) missense probably damaging 1.00
R8894:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably damaging 1.00
R8903:Abca14 UTSW 7 119,815,526 (GRCm39) missense probably damaging 0.98
R8950:Abca14 UTSW 7 119,823,595 (GRCm39) missense possibly damaging 0.92
R8950:Abca14 UTSW 7 119,823,644 (GRCm39) nonsense probably null
R9018:Abca14 UTSW 7 119,918,532 (GRCm39) missense probably damaging 0.98
R9018:Abca14 UTSW 7 119,888,763 (GRCm39) missense probably benign 0.01
R9110:Abca14 UTSW 7 119,831,615 (GRCm39) intron probably benign
R9254:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9376:Abca14 UTSW 7 119,893,438 (GRCm39) missense probably damaging 1.00
R9378:Abca14 UTSW 7 119,807,191 (GRCm39) missense possibly damaging 0.64
R9379:Abca14 UTSW 7 119,807,202 (GRCm39) nonsense probably null
R9388:Abca14 UTSW 7 119,882,261 (GRCm39) missense probably benign 0.01
R9445:Abca14 UTSW 7 119,877,691 (GRCm39) missense probably benign 0.05
R9522:Abca14 UTSW 7 119,847,368 (GRCm39) missense probably null 0.98
R9577:Abca14 UTSW 7 119,810,768 (GRCm39) missense probably benign 0.27
R9627:Abca14 UTSW 7 119,854,530 (GRCm39) missense probably benign 0.00
R9639:Abca14 UTSW 7 119,893,345 (GRCm39) missense probably benign 0.01
R9660:Abca14 UTSW 7 119,851,478 (GRCm39) missense probably benign 0.00
R9709:Abca14 UTSW 7 119,888,739 (GRCm39) nonsense probably null
R9780:Abca14 UTSW 7 119,911,447 (GRCm39) missense probably benign 0.00
Z1088:Abca14 UTSW 7 119,815,358 (GRCm39) missense probably benign 0.14
Z1176:Abca14 UTSW 7 119,846,146 (GRCm39) missense probably damaging 1.00
Z1177:Abca14 UTSW 7 119,917,210 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAAGGGTAGACTAGCTAGTG -3'
(R):5'- TTTACAGATACACAGGGATGACG -3'

Sequencing Primer
(F):5'- GGTAGACTAGCTAGTGGCAAG -3'
(R):5'- GAAAGTCATTCACACAGACTAGTG -3'
Posted On 2022-10-06