Incidental Mutation 'R9697:Magi3'
ID 729349
Institutional Source Beutler Lab
Gene Symbol Magi3
Ensembl Gene ENSMUSG00000052539
Gene Name membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms 4732496O19Rik, 6530407C02Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.435) question?
Stock # R9697 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 103920575-104127690 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 103956458 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000067932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064371] [ENSMUST00000121198] [ENSMUST00000122303]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000064371
SMART Domains Protein: ENSMUSP00000067932
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121198
SMART Domains Protein: ENSMUSP00000112934
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122303
SMART Domains Protein: ENSMUSP00000113713
Gene: ENSMUSG00000052539

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
PDZ 27 108 1.94e-1 SMART
GuKc 114 281 8.56e-10 SMART
WW 297 329 9.14e-12 SMART
WW 343 375 2.47e-8 SMART
PDZ 421 497 1.48e-17 SMART
PDZ 589 659 3.07e-10 SMART
low complexity region 664 674 N/A INTRINSIC
low complexity region 683 698 N/A INTRINSIC
PDZ 737 813 1.34e-15 SMART
PDZ 861 939 7.65e-20 SMART
PDZ 1030 1104 1.55e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 15,163,769 (GRCm39) probably benign Het
9330182O14Rik C T 15: 40,005,500 (GRCm39) probably benign Het
Adamts19 C A 18: 59,101,834 (GRCm39) P635T probably damaging Het
Adgrf1 T C 17: 43,625,362 (GRCm39) W857R possibly damaging Het
Ak9 T G 10: 41,298,968 (GRCm39) Y1556* probably null Het
Ang2 T C 14: 51,433,326 (GRCm39) I19V probably benign Het
Ano3 T A 2: 110,496,253 (GRCm39) T834S probably damaging Het
As3mt A T 19: 46,708,420 (GRCm39) I236F probably benign Het
Asns A T 6: 7,689,268 (GRCm39) I78N probably damaging Het
Bet1 G A 6: 4,082,471 (GRCm39) T44M probably damaging Het
Cabyr T C 18: 12,884,407 (GRCm39) V298A possibly damaging Het
Cacna1c A G 6: 118,589,598 (GRCm39) V1601A Het
Ccni A T 5: 93,350,201 (GRCm39) M26K probably damaging Het
Cdhr2 T C 13: 54,867,679 (GRCm39) I503T probably damaging Het
Cfap54 T C 10: 92,792,851 (GRCm39) K1754R unknown Het
Cfap69 A G 5: 5,676,041 (GRCm39) V218A possibly damaging Het
Clcn3 A G 8: 61,372,518 (GRCm39) L741P probably damaging Het
Cntnap1 T C 11: 101,068,828 (GRCm39) F124L possibly damaging Het
Col20a1 G A 2: 180,641,577 (GRCm39) G673D probably benign Het
Col4a2 A G 8: 11,487,628 (GRCm39) I977V probably benign Het
Cyp3a59 A T 5: 146,031,190 (GRCm39) I118F probably damaging Het
Dgcr8 A T 16: 18,098,283 (GRCm39) D369E probably benign Het
Dhtkd1 T C 2: 5,919,651 (GRCm39) T577A probably benign Het
Dock2 A T 11: 34,204,417 (GRCm39) M1375K probably benign Het
Fa2h G A 8: 112,074,659 (GRCm39) H315Y probably damaging Het
Foxd2 G A 4: 114,765,684 (GRCm39) P112L unknown Het
Gin1 A G 1: 97,712,897 (GRCm39) I317V probably benign Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
H2-T3 T A 17: 36,500,744 (GRCm39) Y33F probably damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il12rb1 G A 8: 71,263,874 (GRCm39) W145* probably null Het
Il6ra A G 3: 89,785,219 (GRCm39) V330A probably benign Het
Impdh2 T C 9: 108,438,847 (GRCm39) S67P possibly damaging Het
Ltbp3 T A 19: 5,792,521 (GRCm39) S85T probably benign Het
Mettl4 T A 17: 95,034,806 (GRCm39) I430F probably damaging Het
Mmd T A 11: 90,167,579 (GRCm39) F203I probably damaging Het
Nlgn1 T C 3: 25,494,035 (GRCm39) T305A possibly damaging Het
Ntn1 A G 11: 68,168,356 (GRCm39) V367A probably damaging Het
Or2w1b A T 13: 21,299,892 (GRCm39) H10L probably benign Het
Or5b107 G A 19: 13,142,888 (GRCm39) C170Y possibly damaging Het
Pcdh12 T C 18: 38,415,022 (GRCm39) H701R possibly damaging Het
Pcgf3 G A 5: 108,621,773 (GRCm39) probably null Het
Pik3c2g G A 6: 139,913,517 (GRCm39) V972M unknown Het
Pink1 A G 4: 138,041,323 (GRCm39) C563R possibly damaging Het
Prol1 A T 5: 88,466,426 (GRCm39) N3I probably benign Het
Ptpro T G 6: 137,363,288 (GRCm39) I474S probably damaging Het
Rabgef1 A G 5: 130,241,781 (GRCm39) E395G probably benign Het
Rpgrip1l G T 8: 91,987,391 (GRCm39) H889N possibly damaging Het
Sapcd2 T A 2: 25,262,925 (GRCm39) C161* probably null Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,452,391 (GRCm39) probably benign Het
Spen A G 4: 141,196,275 (GRCm39) L3625P probably damaging Het
Stil T C 4: 114,878,701 (GRCm39) I379T probably benign Het
Stim1 A G 7: 102,078,014 (GRCm39) D172G Het
Timm50 A G 7: 28,010,350 (GRCm39) L68P probably damaging Het
Tlr9 C T 9: 106,100,723 (GRCm39) R5* probably null Het
Top1mt A T 15: 75,547,874 (GRCm39) Y71N probably damaging Het
Trpv4 A G 5: 114,771,285 (GRCm39) Y415H possibly damaging Het
Try10 C T 6: 41,331,041 (GRCm39) probably benign Het
Uhrf2 A G 19: 30,063,780 (GRCm39) E581G probably damaging Het
Usp17lb G A 7: 104,490,495 (GRCm39) T144I possibly damaging Het
Vmn1r64 T C 7: 5,886,859 (GRCm39) N228S probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Other mutations in Magi3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Magi3 APN 3 103,922,294 (GRCm39) missense probably damaging 1.00
IGL00933:Magi3 APN 3 103,923,163 (GRCm39) missense probably benign
IGL01151:Magi3 APN 3 103,958,690 (GRCm39) missense probably damaging 1.00
IGL01674:Magi3 APN 3 104,013,037 (GRCm39) splice site probably benign
IGL01790:Magi3 APN 3 103,992,560 (GRCm39) missense probably damaging 1.00
IGL01903:Magi3 APN 3 103,958,526 (GRCm39) missense possibly damaging 0.87
IGL01939:Magi3 APN 3 103,961,778 (GRCm39) missense probably damaging 0.99
IGL02142:Magi3 APN 3 103,923,219 (GRCm39) missense probably benign 0.32
IGL02183:Magi3 APN 3 103,992,663 (GRCm39) missense probably benign 0.01
IGL02887:Magi3 APN 3 104,002,473 (GRCm39) missense probably damaging 1.00
IGL03071:Magi3 APN 3 103,923,202 (GRCm39) missense possibly damaging 0.51
IGL03085:Magi3 APN 3 103,922,655 (GRCm39) missense possibly damaging 0.88
IGL03192:Magi3 APN 3 103,950,562 (GRCm39) missense probably damaging 1.00
IGL03204:Magi3 APN 3 104,013,151 (GRCm39) missense probably damaging 1.00
IGL03227:Magi3 APN 3 103,958,435 (GRCm39) missense probably benign
IGL03388:Magi3 APN 3 103,923,157 (GRCm39) missense probably benign 0.30
PIT4280001:Magi3 UTSW 3 103,961,668 (GRCm39) missense probably damaging 1.00
PIT4504001:Magi3 UTSW 3 103,922,842 (GRCm39) missense probably benign 0.05
R0092:Magi3 UTSW 3 103,958,280 (GRCm39) nonsense probably null
R0514:Magi3 UTSW 3 103,922,338 (GRCm39) missense probably damaging 1.00
R0569:Magi3 UTSW 3 103,923,358 (GRCm39) missense probably benign 0.43
R0608:Magi3 UTSW 3 103,924,873 (GRCm39) missense probably damaging 1.00
R0920:Magi3 UTSW 3 103,941,507 (GRCm39) splice site probably null
R1173:Magi3 UTSW 3 103,968,946 (GRCm39) critical splice donor site probably null
R1256:Magi3 UTSW 3 103,935,126 (GRCm39) missense probably benign 0.08
R1391:Magi3 UTSW 3 103,922,374 (GRCm39) nonsense probably null
R1559:Magi3 UTSW 3 103,954,169 (GRCm39) splice site probably benign
R1568:Magi3 UTSW 3 103,996,843 (GRCm39) missense probably benign 0.02
R1631:Magi3 UTSW 3 103,958,493 (GRCm39) missense probably benign 0.05
R1747:Magi3 UTSW 3 103,941,489 (GRCm39) missense possibly damaging 0.82
R1930:Magi3 UTSW 3 103,996,920 (GRCm39) missense probably damaging 1.00
R1964:Magi3 UTSW 3 103,927,718 (GRCm39) missense probably damaging 0.99
R2151:Magi3 UTSW 3 103,992,554 (GRCm39) missense probably damaging 1.00
R2151:Magi3 UTSW 3 103,954,198 (GRCm39) missense probably damaging 1.00
R2266:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2267:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2268:Magi3 UTSW 3 103,928,382 (GRCm39) intron probably benign
R2519:Magi3 UTSW 3 103,923,081 (GRCm39) missense probably benign 0.00
R3104:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3105:Magi3 UTSW 3 103,958,636 (GRCm39) missense probably damaging 0.99
R3619:Magi3 UTSW 3 103,961,721 (GRCm39) missense probably damaging 1.00
R4158:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4160:Magi3 UTSW 3 103,958,277 (GRCm39) missense probably damaging 1.00
R4284:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4285:Magi3 UTSW 3 103,923,184 (GRCm39) nonsense probably null
R4397:Magi3 UTSW 3 104,127,030 (GRCm39) missense probably damaging 1.00
R4512:Magi3 UTSW 3 103,996,871 (GRCm39) missense probably damaging 0.99
R4676:Magi3 UTSW 3 103,923,141 (GRCm39) missense probably benign
R4758:Magi3 UTSW 3 103,922,637 (GRCm39) missense probably benign 0.01
R4940:Magi3 UTSW 3 103,958,708 (GRCm39) missense probably damaging 1.00
R5039:Magi3 UTSW 3 104,013,107 (GRCm39) missense probably damaging 1.00
R5160:Magi3 UTSW 3 103,935,224 (GRCm39) missense possibly damaging 0.46
R5422:Magi3 UTSW 3 103,958,684 (GRCm39) missense probably damaging 1.00
R5509:Magi3 UTSW 3 103,922,818 (GRCm39) missense probably benign 0.00
R5839:Magi3 UTSW 3 104,127,047 (GRCm39) missense probably damaging 1.00
R5924:Magi3 UTSW 3 103,961,854 (GRCm39) splice site probably null
R6018:Magi3 UTSW 3 104,013,128 (GRCm39) missense probably damaging 1.00
R6189:Magi3 UTSW 3 103,958,181 (GRCm39) missense probably damaging 1.00
R6235:Magi3 UTSW 3 103,923,384 (GRCm39) missense probably damaging 0.99
R6244:Magi3 UTSW 3 103,923,013 (GRCm39) missense probably benign 0.16
R6258:Magi3 UTSW 3 103,996,912 (GRCm39) missense probably damaging 1.00
R6358:Magi3 UTSW 3 103,958,268 (GRCm39) missense probably damaging 1.00
R6534:Magi3 UTSW 3 103,992,536 (GRCm39) missense possibly damaging 0.75
R6806:Magi3 UTSW 3 103,954,285 (GRCm39) missense possibly damaging 0.94
R6816:Magi3 UTSW 3 103,997,227 (GRCm39) splice site probably null
R6897:Magi3 UTSW 3 103,996,873 (GRCm39) missense probably damaging 1.00
R7011:Magi3 UTSW 3 104,013,070 (GRCm39) missense probably damaging 1.00
R7039:Magi3 UTSW 3 103,958,699 (GRCm39) missense probably damaging 1.00
R7196:Magi3 UTSW 3 103,956,484 (GRCm39) missense probably benign 0.01
R7237:Magi3 UTSW 3 103,935,227 (GRCm39) missense probably damaging 1.00
R7285:Magi3 UTSW 3 103,941,430 (GRCm39) missense probably benign 0.00
R7709:Magi3 UTSW 3 103,941,354 (GRCm39) missense probably damaging 1.00
R7724:Magi3 UTSW 3 103,923,243 (GRCm39) missense probably benign 0.04
R7797:Magi3 UTSW 3 103,958,618 (GRCm39) missense probably damaging 1.00
R7950:Magi3 UTSW 3 103,924,005 (GRCm39) missense probably damaging 1.00
R8140:Magi3 UTSW 3 103,941,402 (GRCm39) missense probably damaging 1.00
R8204:Magi3 UTSW 3 103,958,502 (GRCm39) missense probably benign
R8229:Magi3 UTSW 3 103,923,018 (GRCm39) missense probably benign 0.00
R8229:Magi3 UTSW 3 103,923,017 (GRCm39) missense possibly damaging 0.79
R8260:Magi3 UTSW 3 103,922,625 (GRCm39) missense probably benign 0.01
R8348:Magi3 UTSW 3 103,958,531 (GRCm39) missense probably damaging 1.00
R8368:Magi3 UTSW 3 104,002,379 (GRCm39) critical splice donor site probably null
R8543:Magi3 UTSW 3 104,126,984 (GRCm39) missense probably damaging 0.98
R8762:Magi3 UTSW 3 103,958,169 (GRCm39) missense probably damaging 1.00
R8826:Magi3 UTSW 3 103,992,662 (GRCm39) missense probably benign 0.00
R8847:Magi3 UTSW 3 103,922,334 (GRCm39) missense probably benign 0.09
R8892:Magi3 UTSW 3 103,958,141 (GRCm39) missense probably damaging 1.00
R8939:Magi3 UTSW 3 103,996,748 (GRCm39) intron probably benign
R9090:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9187:Magi3 UTSW 3 103,923,073 (GRCm39) missense possibly damaging 0.76
R9271:Magi3 UTSW 3 103,923,264 (GRCm39) missense possibly damaging 0.68
R9433:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9439:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9557:Magi3 UTSW 3 103,924,933 (GRCm39) missense probably damaging 1.00
R9557:Magi3 UTSW 3 103,922,473 (GRCm39) missense probably benign 0.01
R9796:Magi3 UTSW 3 103,928,291 (GRCm39) missense probably benign
X0026:Magi3 UTSW 3 103,927,736 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACAGACTTCAAAGGGAG -3'
(R):5'- CTGTTTCTGTGATTTAAGGAACCTC -3'

Sequencing Primer
(F):5'- AAGGGAGTTTCCTATCAATACCTGGG -3'
(R):5'- GCCTGACACGTTGTTGAT -3'
Posted On 2022-10-06