Incidental Mutation 'R9697:Stim1'
ID 729372
Institutional Source Beutler Lab
Gene Symbol Stim1
Ensembl Gene ENSMUSG00000030987
Gene Name stromal interaction molecule 1
Synonyms SIM
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9697 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 102267806-102437319 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102428807 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 172 (D172G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]
AlphaFold P70302
Predicted Effect probably benign
Transcript: ENSMUST00000033289
SMART Domains Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
SAM 129 200 5.51e-6 SMART
SCOP:d1eq1a_ 229 334 1e-2 SMART
PDB:4O9B|D 237 340 3e-59 PDB
Pfam:SOAR 341 441 1.4e-46 PFAM
low complexity region 485 499 N/A INTRINSIC
low complexity region 601 631 N/A INTRINSIC
low complexity region 672 685 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209255
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000211457
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,507 probably benign Het
9330182O14Rik C T 15: 40,142,104 probably benign Het
Adamts19 C A 18: 58,968,762 P635T probably damaging Het
Adgrf1 T C 17: 43,314,471 W857R possibly damaging Het
Ak9 T G 10: 41,422,972 Y1556* probably null Het
Ang2 T C 14: 51,195,869 I19V probably benign Het
Ano3 T A 2: 110,665,908 T834S probably damaging Het
As3mt A T 19: 46,719,981 I236F probably benign Het
Asns A T 6: 7,689,268 I78N probably damaging Het
Bet1 G A 6: 4,082,471 T44M probably damaging Het
Cabyr T C 18: 12,751,350 V298A possibly damaging Het
Cacna1c A G 6: 118,612,637 V1601A Het
Ccni A T 5: 93,202,342 M26K probably damaging Het
Cdhr2 T C 13: 54,719,866 I503T probably damaging Het
Cfap54 T C 10: 92,956,989 K1754R unknown Het
Cfap69 A G 5: 5,626,041 V218A possibly damaging Het
Clcn3 A G 8: 60,919,484 L741P probably damaging Het
Cntnap1 T C 11: 101,178,002 F124L possibly damaging Het
Col20a1 G A 2: 180,999,784 G673D probably benign Het
Col4a2 A G 8: 11,437,628 I977V probably benign Het
Cyp3a59 A T 5: 146,094,380 I118F probably damaging Het
Dgcr8 A T 16: 18,280,419 D369E probably benign Het
Dhtkd1 T C 2: 5,914,840 T577A probably benign Het
Dock2 A T 11: 34,254,417 M1375K probably benign Het
Fa2h G A 8: 111,348,027 H315Y probably damaging Het
Foxd2 G A 4: 114,908,487 P112L unknown Het
Gin1 A G 1: 97,785,172 I317V probably benign Het
Gpr180 G A 14: 118,153,890 G235R probably damaging Het
H2-T3 T A 17: 36,189,852 Y33F probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il12rb1 G A 8: 70,811,230 W145* probably null Het
Il6ra A G 3: 89,877,912 V330A probably benign Het
Impdh2 T C 9: 108,561,648 S67P possibly damaging Het
Ltbp3 T A 19: 5,742,493 S85T probably benign Het
Magi3 A G 3: 104,049,142 probably null Het
Mettl4 T A 17: 94,727,378 I430F probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Nlgn1 T C 3: 25,439,871 T305A possibly damaging Het
Ntn1 A G 11: 68,277,530 V367A probably damaging Het
Olfr1369-ps1 A T 13: 21,115,722 H10L probably benign Het
Olfr1461 G A 19: 13,165,524 C170Y possibly damaging Het
Pcdh12 T C 18: 38,281,969 H701R possibly damaging Het
Pcgf3 G A 5: 108,473,907 probably null Het
Pik3c2g G A 6: 139,967,791 V972M unknown Het
Pink1 A G 4: 138,314,012 C563R possibly damaging Het
Prol1 A T 5: 88,318,567 N3I probably benign Het
Ptpro T G 6: 137,386,290 I474S probably damaging Het
Rabgef1 A G 5: 130,212,940 E395G probably benign Het
Rpgrip1l G T 8: 91,260,763 H889N possibly damaging Het
Sapcd2 T A 2: 25,372,913 C161* probably null Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spen A G 4: 141,468,964 L3625P probably damaging Het
Stil T C 4: 115,021,504 I379T probably benign Het
Timm50 A G 7: 28,310,925 L68P probably damaging Het
Tlr9 C T 9: 106,223,524 R5* probably null Het
Top1mt A T 15: 75,676,025 Y71N probably damaging Het
Trpv4 A G 5: 114,633,224 Y415H possibly damaging Het
Try10 C T 6: 41,354,107 probably benign Het
Uhrf2 A G 19: 30,086,380 E581G probably damaging Het
Usp17lb G A 7: 104,841,288 T144I possibly damaging Het
Vmn1r64 T C 7: 5,883,860 N228S probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Other mutations in Stim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Stim1 APN 7 102426747 missense probably damaging 1.00
IGL01390:Stim1 APN 7 102427162 missense possibly damaging 0.73
IGL01602:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01605:Stim1 APN 7 102386115 missense possibly damaging 0.86
IGL01697:Stim1 APN 7 102425969 splice site probably benign
IGL01826:Stim1 APN 7 102427075 splice site probably benign
IGL01908:Stim1 APN 7 102435650 missense probably benign
IGL02869:Stim1 APN 7 102268551 missense unknown
IGL03146:Stim1 APN 7 102421355 missense probably damaging 1.00
R0217:Stim1 UTSW 7 102435800 missense probably benign 0.00
R1320:Stim1 UTSW 7 102408406 missense possibly damaging 0.79
R1639:Stim1 UTSW 7 102354541 missense probably benign 0.31
R1643:Stim1 UTSW 7 102386100 missense possibly damaging 0.92
R1697:Stim1 UTSW 7 102354506 missense probably damaging 1.00
R2424:Stim1 UTSW 7 102408405 missense probably benign 0.03
R3838:Stim1 UTSW 7 102411296 missense possibly damaging 0.71
R3940:Stim1 UTSW 7 102435641 missense probably benign 0.00
R4820:Stim1 UTSW 7 102415364 missense probably damaging 0.97
R4871:Stim1 UTSW 7 102354572 missense probably damaging 1.00
R5110:Stim1 UTSW 7 102268422 missense unknown
R5787:Stim1 UTSW 7 102435440 missense possibly damaging 0.52
R6400:Stim1 UTSW 7 102430950 missense probably null 0.99
R6788:Stim1 UTSW 7 102427291 missense probably damaging 0.99
R7112:Stim1 UTSW 7 102408408 missense probably benign 0.01
R7125:Stim1 UTSW 7 102435534 missense possibly damaging 0.69
R7247:Stim1 UTSW 7 102421532 critical splice donor site probably null
R7650:Stim1 UTSW 7 102428827 missense
R7807:Stim1 UTSW 7 102427141 missense probably damaging 0.99
R8304:Stim1 UTSW 7 102435481 missense possibly damaging 0.55
R8462:Stim1 UTSW 7 102427117 missense probably damaging 1.00
R8528:Stim1 UTSW 7 102431082 intron probably benign
R8883:Stim1 UTSW 7 102431050 missense unknown
R8921:Stim1 UTSW 7 102421390 missense probably damaging 0.99
R8924:Stim1 UTSW 7 102428807 missense
R9018:Stim1 UTSW 7 102411275 missense probably benign 0.05
R9164:Stim1 UTSW 7 102435419 missense probably benign 0.35
R9396:Stim1 UTSW 7 102415385 missense possibly damaging 0.63
R9487:Stim1 UTSW 7 102431050 missense unknown
R9501:Stim1 UTSW 7 102411299 missense possibly damaging 0.92
R9710:Stim1 UTSW 7 102430911 small deletion probably benign
R9734:Stim1 UTSW 7 102415353 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTGATCCAATGCTCCCATGC -3'
(R):5'- ACCCCTCCCTTCAGTTAGTAAG -3'

Sequencing Primer
(F):5'- CTCTCCGGGTTAGGGAAAAGCTTC -3'
(R):5'- CCCTTCAGTTAGTAAGGACAGTGC -3'
Posted On 2022-10-06