Mutagenetix > Incidental Mutation

Incidental Mutation 'R9697:Clcn3'

729375

Institutional Source

Beutler Lab

Gene Symbol

Clcn3

Ensembl Gene

ENSMUSG00000004319

Gene Name

chloride channel, voltage-sensitive 3

Synonyms

Clc3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.427) question?

Stock #

R9697 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60910389-60983300 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 60919484 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 741 (L741P)

Ref Sequence

ENSEMBL: ENSMUSP00000004430 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004430] [ENSMUST00000056508] [ENSMUST00000093490] [ENSMUST00000110301] [ENSMUST00000110302]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000004430
AA Change: L741P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000004430
Gene: ENSMUSG00000004319
AA Change: L741P

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	1.4e-111	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	2.08e-8	SMART
low complexity region	847	861	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000056508
AA Change: L714P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000058648
Gene: ENSMUSG00000004319
AA Change: L714P

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.4e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000093490
AA Change: L683P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000091202
Gene: ENSMUSG00000004319
AA Change: L683P

Domain	Start	End	E-Value	Type
transmembrane domain	70	92	N/A	INTRINSIC
Pfam:Voltage_CLC	162	565	1.2e-103	PFAM
CBS	609	659	2.46e-1	SMART
CBS	700	747	6.59e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110301
AA Change: L741P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000105930
Gene: ENSMUSG00000004319
AA Change: L741P

Domain	Start	End	E-Value	Type
transmembrane domain	128	150	N/A	INTRINSIC
Pfam:Voltage_CLC	220	623	2.7e-103	PFAM
CBS	667	717	2.46e-1	SMART
CBS	758	805	6.59e-11	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110302
AA Change: L714P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105931
Gene: ENSMUSG00000004319
AA Change: L714P

Domain	Start	End	E-Value	Type
transmembrane domain	101	123	N/A	INTRINSIC
Pfam:Voltage_CLC	193	596	1.3e-103	PFAM
CBS	640	690	2.46e-1	SMART
CBS	731	778	2.08e-8	SMART
low complexity region	820	834	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the voltage-gated chloride channel (ClC) family. The encoded protein is present in all cell types and localized in plasma membranes and in intracellular vesicles. It is a multi-pass membrane protein which contains a ClC domain and two additional C-terminal CBS (cystathionine beta-synthase) domains. The ClC domain catalyzes the selective flow of Cl- ions across cell membranes, and the CBS domain may have a regulatory function. This protein plays a role in both acidification and transmitter loading of GABAergic synaptic vesicles, and in smooth muscle cell activation and neointima formation. This protein is required for lysophosphatidic acid (LPA)-activated Cl- current activity and fibroblast-to-myofibroblast differentiation. The protein activity is regulated by Ca(2+)/calmodulin-dependent protein kinase II (CaMKII) in glioma cells. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations cause degeneration of hippocampal neurons and retinal photoreceptors, reduced body weight, behavioral deficits, gliosis, kyphosis and premature death, and may alter male fertility, ileum morphology, liver physiology, seizure susceptibility, and behavioral response to drugs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600012H06Rik	C	T	17: 14,943,507		probably benign	Het
9330182O14Rik	C	T	15: 40,142,104		probably benign	Het
Adamts19	C	A	18: 58,968,762	P635T	probably damaging	Het
Adgrf1	T	C	17: 43,314,471	W857R	possibly damaging	Het
Ak9	T	G	10: 41,422,972	Y1556*	probably null	Het
Ang2	T	C	14: 51,195,869	I19V	probably benign	Het
Ano3	T	A	2: 110,665,908	T834S	probably damaging	Het
As3mt	A	T	19: 46,719,981	I236F	probably benign	Het
Asns	A	T	6: 7,689,268	I78N	probably damaging	Het
Bet1	G	A	6: 4,082,471	T44M	probably damaging	Het
Cabyr	T	C	18: 12,751,350	V298A	possibly damaging	Het
Cacna1c	A	G	6: 118,612,637	V1601A		Het
Ccni	A	T	5: 93,202,342	M26K	probably damaging	Het
Cdhr2	T	C	13: 54,719,866	I503T	probably damaging	Het
Cfap54	T	C	10: 92,956,989	K1754R	unknown	Het
Cfap69	A	G	5: 5,626,041	V218A	possibly damaging	Het
Cntnap1	T	C	11: 101,178,002	F124L	possibly damaging	Het
Col20a1	G	A	2: 180,999,784	G673D	probably benign	Het
Col4a2	A	G	8: 11,437,628	I977V	probably benign	Het
Cyp3a59	A	T	5: 146,094,380	I118F	probably damaging	Het
Dgcr8	A	T	16: 18,280,419	D369E	probably benign	Het
Dhtkd1	T	C	2: 5,914,840	T577A	probably benign	Het
Dock2	A	T	11: 34,254,417	M1375K	probably benign	Het
Fa2h	G	A	8: 111,348,027	H315Y	probably damaging	Het
Foxd2	G	A	4: 114,908,487	P112L	unknown	Het
Gin1	A	G	1: 97,785,172	I317V	probably benign	Het
Gpr180	G	A	14: 118,153,890	G235R	probably damaging	Het
H2-T3	T	A	17: 36,189,852	Y33F	probably damaging	Het
Idh2	TCCCAGG	T	7: 80,098,331		probably benign	Het
Il12rb1	G	A	8: 70,811,230	W145*	probably null	Het
Il6ra	A	G	3: 89,877,912	V330A	probably benign	Het
Impdh2	T	C	9: 108,561,648	S67P	possibly damaging	Het
Ltbp3	T	A	19: 5,742,493	S85T	probably benign	Het
Magi3	A	G	3: 104,049,142		probably null	Het
Mettl4	T	A	17: 94,727,378	I430F	probably damaging	Het
Mmd	T	A	11: 90,276,753	F203I	probably damaging	Het
Nlgn1	T	C	3: 25,439,871	T305A	possibly damaging	Het
Ntn1	A	G	11: 68,277,530	V367A	probably damaging	Het
Olfr1369-ps1	A	T	13: 21,115,722	H10L	probably benign	Het
Olfr1461	G	A	19: 13,165,524	C170Y	possibly damaging	Het
Pcdh12	T	C	18: 38,281,969	H701R	possibly damaging	Het
Pcgf3	G	A	5: 108,473,907		probably null	Het
Pik3c2g	G	A	6: 139,967,791	V972M	unknown	Het
Pink1	A	G	4: 138,314,012	C563R	possibly damaging	Het
Prol1	A	T	5: 88,318,567	N3I	probably benign	Het
Ptpro	T	G	6: 137,386,290	I474S	probably damaging	Het
Rabgef1	A	G	5: 130,212,940	E395G	probably benign	Het
Rpgrip1l	G	T	8: 91,260,763	H889N	possibly damaging	Het
Sapcd2	T	A	2: 25,372,913	C161*	probably null	Het
Sbsn	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA	7: 30,752,966		probably benign	Het
Spen	A	G	4: 141,468,964	L3625P	probably damaging	Het
Stil	T	C	4: 115,021,504	I379T	probably benign	Het
Stim1	A	G	7: 102,428,807	D172G		Het
Timm50	A	G	7: 28,310,925	L68P	probably damaging	Het
Tlr9	C	T	9: 106,223,524	R5*	probably null	Het
Top1mt	A	T	15: 75,676,025	Y71N	probably damaging	Het
Trpv4	A	G	5: 114,633,224	Y415H	possibly damaging	Het
Try10	C	T	6: 41,354,107		probably benign	Het
Uhrf2	A	G	19: 30,086,380	E581G	probably damaging	Het
Usp17lb	G	A	7: 104,841,288	T144I	possibly damaging	Het
Vmn1r64	T	C	7: 5,883,860	N228S	probably benign	Het
Vwa1	G	A	4: 155,772,879	P154L	probably damaging	Het

Other mutations in Clcn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00782:Clcn3	APN	8	60922792	missense	probably damaging	0.99
IGL01088:Clcn3	APN	8	60937347	missense	probably damaging	1.00
IGL01449:Clcn3	APN	8	60934598	missense	probably damaging	0.97
IGL01792:Clcn3	APN	8	60929322	missense	probably damaging	1.00
IGL01845:Clcn3	APN	8	60913095	missense	probably benign	0.08
IGL01984:Clcn3	APN	8	60929580	missense	probably damaging	1.00
IGL02041:Clcn3	APN	8	60923153	missense	probably damaging	0.99
IGL02199:Clcn3	APN	8	60933092	nonsense	probably null
IGL02199:Clcn3	APN	8	60927274	missense	possibly damaging	0.82
IGL02456:Clcn3	APN	8	60941357	missense	probably damaging	1.00
IGL03353:Clcn3	APN	8	60922988	missense	probably benign	0.37
Precipice	UTSW	8	60941399	missense	probably benign	0.16
R0003:Clcn3	UTSW	8	60927296	nonsense	probably null
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0023:Clcn3	UTSW	8	60933070	splice site	probably benign
R0349:Clcn3	UTSW	8	60941348	missense	possibly damaging	0.91
R0437:Clcn3	UTSW	8	60934537	missense	possibly damaging	0.69
R0784:Clcn3	UTSW	8	60929203	missense	probably benign	0.25
R0840:Clcn3	UTSW	8	60929154	missense	probably benign	0.22
R1167:Clcn3	UTSW	8	60922788	critical splice donor site	probably null
R2035:Clcn3	UTSW	8	60934598	missense	probably damaging	0.97
R2193:Clcn3	UTSW	8	60929187	missense	possibly damaging	0.56
R3697:Clcn3	UTSW	8	60913123	missense	probably benign	0.02
R3736:Clcn3	UTSW	8	60983652	unclassified	probably benign
R4676:Clcn3	UTSW	8	60930651	intron	probably benign
R4807:Clcn3	UTSW	8	60934530	missense	probably damaging	1.00
R5112:Clcn3	UTSW	8	60954552	missense	probably benign	0.07
R5200:Clcn3	UTSW	8	60923005	missense	probably damaging	0.99
R5652:Clcn3	UTSW	8	60919353	missense	possibly damaging	0.81
R5712:Clcn3	UTSW	8	60937298	critical splice donor site	probably null
R5731:Clcn3	UTSW	8	60922889	missense	possibly damaging	0.46
R5814:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6134:Clcn3	UTSW	8	60934573	missense	probably damaging	1.00
R6370:Clcn3	UTSW	8	60923024	missense	probably damaging	1.00
R6371:Clcn3	UTSW	8	60937335	missense	probably benign	0.06
R6394:Clcn3	UTSW	8	60941291	missense	probably damaging	0.99
R6466:Clcn3	UTSW	8	60929561	missense	probably damaging	1.00
R6588:Clcn3	UTSW	8	60914827	missense	probably benign	0.03
R6750:Clcn3	UTSW	8	60914775	missense	possibly damaging	0.93
R7522:Clcn3	UTSW	8	60941412	missense	probably benign
R7556:Clcn3	UTSW	8	60929487	missense	probably damaging	0.99
R7557:Clcn3	UTSW	8	60937368	missense	probably damaging	0.99
R7685:Clcn3	UTSW	8	60933085	missense	possibly damaging	0.54
R7887:Clcn3	UTSW	8	60941399	missense	probably benign	0.16
R8219:Clcn3	UTSW	8	60922966	missense	probably damaging	0.98
R8478:Clcn3	UTSW	8	60919488	missense	probably benign
R8825:Clcn3	UTSW	8	60929488	missense	probably damaging	0.99
R9132:Clcn3	UTSW	8	60929102	missense	probably damaging	0.99
R9313:Clcn3	UTSW	8	60937469	missense	probably damaging	0.99
R9473:Clcn3	UTSW	8	60954617	missense	probably benign	0.01
R9475:Clcn3	UTSW	8	60934517	missense	probably damaging	0.96
R9598:Clcn3	UTSW	8	60913027	missense	unknown
R9718:Clcn3	UTSW	8	60937400	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- CAGTGAGTCAGCTGTCTTCTG -3'
(R):5'- ACCTGCTTCCATGTTTCTGAAG -3'

Sequencing Primer
(F):5'- CAGCTGTCTTCTGTAGTGTTAAAC -3'
(R):5'- GTTCAGCACCATTGAAAATCATAC -3'

Posted On

2022-10-06