Incidental Mutation 'R9697:Ntn1'
ID 729384
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock # R9697 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 68209364-68400823 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68277530 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000104314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674]
AlphaFold O09118
Predicted Effect probably damaging
Transcript: ENSMUST00000021284
AA Change: V367A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: V367A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108674
AA Change: V367A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: V367A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 14,943,507 probably benign Het
9330182O14Rik C T 15: 40,142,104 probably benign Het
Adamts19 C A 18: 58,968,762 P635T probably damaging Het
Adgrf1 T C 17: 43,314,471 W857R possibly damaging Het
Ak9 T G 10: 41,422,972 Y1556* probably null Het
Ang2 T C 14: 51,195,869 I19V probably benign Het
Ano3 T A 2: 110,665,908 T834S probably damaging Het
As3mt A T 19: 46,719,981 I236F probably benign Het
Asns A T 6: 7,689,268 I78N probably damaging Het
Bet1 G A 6: 4,082,471 T44M probably damaging Het
Cabyr T C 18: 12,751,350 V298A possibly damaging Het
Cacna1c A G 6: 118,612,637 V1601A Het
Ccni A T 5: 93,202,342 M26K probably damaging Het
Cdhr2 T C 13: 54,719,866 I503T probably damaging Het
Cfap54 T C 10: 92,956,989 K1754R unknown Het
Cfap69 A G 5: 5,626,041 V218A possibly damaging Het
Clcn3 A G 8: 60,919,484 L741P probably damaging Het
Cntnap1 T C 11: 101,178,002 F124L possibly damaging Het
Col20a1 G A 2: 180,999,784 G673D probably benign Het
Col4a2 A G 8: 11,437,628 I977V probably benign Het
Cyp3a59 A T 5: 146,094,380 I118F probably damaging Het
Dgcr8 A T 16: 18,280,419 D369E probably benign Het
Dhtkd1 T C 2: 5,914,840 T577A probably benign Het
Dock2 A T 11: 34,254,417 M1375K probably benign Het
Fa2h G A 8: 111,348,027 H315Y probably damaging Het
Foxd2 G A 4: 114,908,487 P112L unknown Het
Gin1 A G 1: 97,785,172 I317V probably benign Het
Gpr180 G A 14: 118,153,890 G235R probably damaging Het
H2-T3 T A 17: 36,189,852 Y33F probably damaging Het
Idh2 TCCCAGG T 7: 80,098,331 probably benign Het
Il12rb1 G A 8: 70,811,230 W145* probably null Het
Il6ra A G 3: 89,877,912 V330A probably benign Het
Impdh2 T C 9: 108,561,648 S67P possibly damaging Het
Ltbp3 T A 19: 5,742,493 S85T probably benign Het
Magi3 A G 3: 104,049,142 probably null Het
Mettl4 T A 17: 94,727,378 I430F probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Nlgn1 T C 3: 25,439,871 T305A possibly damaging Het
Olfr1369-ps1 A T 13: 21,115,722 H10L probably benign Het
Olfr1461 G A 19: 13,165,524 C170Y possibly damaging Het
Pcdh12 T C 18: 38,281,969 H701R possibly damaging Het
Pcgf3 G A 5: 108,473,907 probably null Het
Pik3c2g G A 6: 139,967,791 V972M unknown Het
Pink1 A G 4: 138,314,012 C563R possibly damaging Het
Prol1 A T 5: 88,318,567 N3I probably benign Het
Ptpro T G 6: 137,386,290 I474S probably damaging Het
Rabgef1 A G 5: 130,212,940 E395G probably benign Het
Rpgrip1l G T 8: 91,260,763 H889N possibly damaging Het
Sapcd2 T A 2: 25,372,913 C161* probably null Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spen A G 4: 141,468,964 L3625P probably damaging Het
Stil T C 4: 115,021,504 I379T probably benign Het
Stim1 A G 7: 102,428,807 D172G Het
Timm50 A G 7: 28,310,925 L68P probably damaging Het
Tlr9 C T 9: 106,223,524 R5* probably null Het
Top1mt A T 15: 75,676,025 Y71N probably damaging Het
Trpv4 A G 5: 114,633,224 Y415H possibly damaging Het
Try10 C T 6: 41,354,107 probably benign Het
Uhrf2 A G 19: 30,086,380 E581G probably damaging Het
Usp17lb G A 7: 104,841,288 T144I possibly damaging Het
Vmn1r64 T C 7: 5,883,860 N228S probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68226619 splice site probably benign
IGL00972:Ntn1 APN 11 68213272 missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68226604 missense probably benign 0.00
IGL01731:Ntn1 APN 11 68385418 missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68213263 missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68277530 missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68385469 missense probably benign 0.06
R0363:Ntn1 UTSW 11 68385543 missense probably benign 0.44
R1201:Ntn1 UTSW 11 68213226 missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68213133 small deletion probably benign
R1913:Ntn1 UTSW 11 68213185 missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68385294 missense probably benign 0.12
R2248:Ntn1 UTSW 11 68277572 missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68385612 missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68385864 missense probably benign 0.00
R3830:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68385793 missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68385910 missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68213026 small deletion probably benign
R4871:Ntn1 UTSW 11 68213026 small deletion probably benign
R4952:Ntn1 UTSW 11 68213026 small deletion probably benign
R5001:Ntn1 UTSW 11 68260532 missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68385712 missense probably benign 0.37
R6217:Ntn1 UTSW 11 68213332 missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68213199 missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68385750 missense probably benign 0.00
R7172:Ntn1 UTSW 11 68385667 missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68386089 missense probably benign 0.15
R8314:Ntn1 UTSW 11 68385624 missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68226571 missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68385187 missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68257659 intron probably benign
R9752:Ntn1 UTSW 11 68385886 missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68385636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTTGCAGGGGAACTAGAAG -3'
(R):5'- CGTGTTTCCAAGTGCCTTCG -3'

Sequencing Primer
(F):5'- AAAAGGGAGGATGGGGAGAG -3'
(R):5'- CAAGCCGCTCCTGACTG -3'
Posted On 2022-10-06