Incidental Mutation 'R9697:Ntn1'
ID 729384
Institutional Source Beutler Lab
Gene Symbol Ntn1
Ensembl Gene ENSMUSG00000020902
Gene Name netrin 1
Synonyms Netrin-1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.735) question?
Stock # R9697 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 68100190-68277652 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 68168356 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000104314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021284] [ENSMUST00000108674]
AlphaFold O09118
Predicted Effect probably damaging
Transcript: ENSMUST00000021284
AA Change: V367A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021284
Gene: ENSMUSG00000020902
AA Change: V367A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108674
AA Change: V367A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104314
Gene: ENSMUSG00000020902
AA Change: V367A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
LamNT 45 283 7.14e-148 SMART
EGF_Lam 285 338 2.44e-9 SMART
EGF_Lam 341 401 3.01e-9 SMART
EGF_Lam 404 451 8.43e-13 SMART
C345C 487 595 1.67e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Netrin is included in a family of laminin-related secreted proteins. The function of this gene has not yet been defined; however, netrin is thought to be involved in axon guidance and cell migration during development. Mutations and loss of expression of netrin suggest that variation in netrin may be involved in cancer development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit impaired axonal migration, abnormal semicircular canals, lack of corpus callosum, aberrant commissures, hypoplasia of the optic nerve, motor and balance defects, failure to suckle, and neonatal death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600012H06Rik C T 17: 15,163,769 (GRCm39) probably benign Het
9330182O14Rik C T 15: 40,005,500 (GRCm39) probably benign Het
Adamts19 C A 18: 59,101,834 (GRCm39) P635T probably damaging Het
Adgrf1 T C 17: 43,625,362 (GRCm39) W857R possibly damaging Het
Ak9 T G 10: 41,298,968 (GRCm39) Y1556* probably null Het
Ang2 T C 14: 51,433,326 (GRCm39) I19V probably benign Het
Ano3 T A 2: 110,496,253 (GRCm39) T834S probably damaging Het
As3mt A T 19: 46,708,420 (GRCm39) I236F probably benign Het
Asns A T 6: 7,689,268 (GRCm39) I78N probably damaging Het
Bet1 G A 6: 4,082,471 (GRCm39) T44M probably damaging Het
Cabyr T C 18: 12,884,407 (GRCm39) V298A possibly damaging Het
Cacna1c A G 6: 118,589,598 (GRCm39) V1601A Het
Ccni A T 5: 93,350,201 (GRCm39) M26K probably damaging Het
Cdhr2 T C 13: 54,867,679 (GRCm39) I503T probably damaging Het
Cfap54 T C 10: 92,792,851 (GRCm39) K1754R unknown Het
Cfap69 A G 5: 5,676,041 (GRCm39) V218A possibly damaging Het
Clcn3 A G 8: 61,372,518 (GRCm39) L741P probably damaging Het
Cntnap1 T C 11: 101,068,828 (GRCm39) F124L possibly damaging Het
Col20a1 G A 2: 180,641,577 (GRCm39) G673D probably benign Het
Col4a2 A G 8: 11,487,628 (GRCm39) I977V probably benign Het
Cyp3a59 A T 5: 146,031,190 (GRCm39) I118F probably damaging Het
Dgcr8 A T 16: 18,098,283 (GRCm39) D369E probably benign Het
Dhtkd1 T C 2: 5,919,651 (GRCm39) T577A probably benign Het
Dock2 A T 11: 34,204,417 (GRCm39) M1375K probably benign Het
Fa2h G A 8: 112,074,659 (GRCm39) H315Y probably damaging Het
Foxd2 G A 4: 114,765,684 (GRCm39) P112L unknown Het
Gin1 A G 1: 97,712,897 (GRCm39) I317V probably benign Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
H2-T3 T A 17: 36,500,744 (GRCm39) Y33F probably damaging Het
Idh2 TCCCAGG T 7: 79,748,079 (GRCm39) probably benign Het
Il12rb1 G A 8: 71,263,874 (GRCm39) W145* probably null Het
Il6ra A G 3: 89,785,219 (GRCm39) V330A probably benign Het
Impdh2 T C 9: 108,438,847 (GRCm39) S67P possibly damaging Het
Ltbp3 T A 19: 5,792,521 (GRCm39) S85T probably benign Het
Magi3 A G 3: 103,956,458 (GRCm39) probably null Het
Mettl4 T A 17: 95,034,806 (GRCm39) I430F probably damaging Het
Mmd T A 11: 90,167,579 (GRCm39) F203I probably damaging Het
Nlgn1 T C 3: 25,494,035 (GRCm39) T305A possibly damaging Het
Or2w1b A T 13: 21,299,892 (GRCm39) H10L probably benign Het
Or5b107 G A 19: 13,142,888 (GRCm39) C170Y possibly damaging Het
Pcdh12 T C 18: 38,415,022 (GRCm39) H701R possibly damaging Het
Pcgf3 G A 5: 108,621,773 (GRCm39) probably null Het
Pik3c2g G A 6: 139,913,517 (GRCm39) V972M unknown Het
Pink1 A G 4: 138,041,323 (GRCm39) C563R possibly damaging Het
Prol1 A T 5: 88,466,426 (GRCm39) N3I probably benign Het
Ptpro T G 6: 137,363,288 (GRCm39) I474S probably damaging Het
Rabgef1 A G 5: 130,241,781 (GRCm39) E395G probably benign Het
Rpgrip1l G T 8: 91,987,391 (GRCm39) H889N possibly damaging Het
Sapcd2 T A 2: 25,262,925 (GRCm39) C161* probably null Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,452,391 (GRCm39) probably benign Het
Spen A G 4: 141,196,275 (GRCm39) L3625P probably damaging Het
Stil T C 4: 114,878,701 (GRCm39) I379T probably benign Het
Stim1 A G 7: 102,078,014 (GRCm39) D172G Het
Timm50 A G 7: 28,010,350 (GRCm39) L68P probably damaging Het
Tlr9 C T 9: 106,100,723 (GRCm39) R5* probably null Het
Top1mt A T 15: 75,547,874 (GRCm39) Y71N probably damaging Het
Trpv4 A G 5: 114,771,285 (GRCm39) Y415H possibly damaging Het
Try10 C T 6: 41,331,041 (GRCm39) probably benign Het
Uhrf2 A G 19: 30,063,780 (GRCm39) E581G probably damaging Het
Usp17lb G A 7: 104,490,495 (GRCm39) T144I possibly damaging Het
Vmn1r64 T C 7: 5,886,859 (GRCm39) N228S probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Other mutations in Ntn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ntn1 APN 11 68,117,445 (GRCm39) splice site probably benign
IGL00972:Ntn1 APN 11 68,104,098 (GRCm39) missense possibly damaging 0.83
IGL01695:Ntn1 APN 11 68,117,430 (GRCm39) missense probably benign 0.00
IGL01731:Ntn1 APN 11 68,276,244 (GRCm39) missense probably damaging 1.00
IGL02008:Ntn1 APN 11 68,104,089 (GRCm39) missense probably damaging 1.00
IGL02584:Ntn1 APN 11 68,168,356 (GRCm39) missense probably damaging 1.00
IGL02664:Ntn1 APN 11 68,276,295 (GRCm39) missense probably benign 0.06
R0363:Ntn1 UTSW 11 68,276,369 (GRCm39) missense probably benign 0.44
R1201:Ntn1 UTSW 11 68,104,052 (GRCm39) missense probably damaging 0.96
R1268:Ntn1 UTSW 11 68,103,959 (GRCm39) small deletion probably benign
R1913:Ntn1 UTSW 11 68,104,011 (GRCm39) missense probably damaging 1.00
R2245:Ntn1 UTSW 11 68,276,120 (GRCm39) missense probably benign 0.12
R2248:Ntn1 UTSW 11 68,168,398 (GRCm39) missense possibly damaging 0.95
R2359:Ntn1 UTSW 11 68,276,438 (GRCm39) missense probably damaging 1.00
R2862:Ntn1 UTSW 11 68,276,690 (GRCm39) missense probably benign 0.00
R3830:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3851:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R3852:Ntn1 UTSW 11 68,276,619 (GRCm39) missense probably damaging 1.00
R4413:Ntn1 UTSW 11 68,276,736 (GRCm39) missense probably damaging 1.00
R4870:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4871:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R4952:Ntn1 UTSW 11 68,103,852 (GRCm39) small deletion probably benign
R5001:Ntn1 UTSW 11 68,151,358 (GRCm39) missense probably damaging 1.00
R5279:Ntn1 UTSW 11 68,276,538 (GRCm39) missense probably benign 0.37
R6217:Ntn1 UTSW 11 68,104,158 (GRCm39) missense possibly damaging 0.91
R6505:Ntn1 UTSW 11 68,104,025 (GRCm39) missense probably damaging 1.00
R6669:Ntn1 UTSW 11 68,276,576 (GRCm39) missense probably benign 0.00
R7172:Ntn1 UTSW 11 68,276,493 (GRCm39) missense probably damaging 1.00
R7411:Ntn1 UTSW 11 68,276,915 (GRCm39) missense probably benign 0.15
R8314:Ntn1 UTSW 11 68,276,450 (GRCm39) missense probably damaging 1.00
R9216:Ntn1 UTSW 11 68,117,397 (GRCm39) missense possibly damaging 0.76
R9385:Ntn1 UTSW 11 68,276,013 (GRCm39) missense probably damaging 1.00
R9442:Ntn1 UTSW 11 68,148,485 (GRCm39) intron probably benign
R9752:Ntn1 UTSW 11 68,276,712 (GRCm39) missense possibly damaging 0.80
X0027:Ntn1 UTSW 11 68,276,462 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTTGCAGGGGAACTAGAAG -3'
(R):5'- CGTGTTTCCAAGTGCCTTCG -3'

Sequencing Primer
(F):5'- AAAAGGGAGGATGGGGAGAG -3'
(R):5'- CAAGCCGCTCCTGACTG -3'
Posted On 2022-10-06