Mutagenetix > Incidental Mutation

Incidental Mutation 'R9698:Cntn6'

729430

Institutional Source

Beutler Lab

Gene Symbol

Cntn6

Ensembl Gene

ENSMUSG00000030092

Gene Name

contactin 6

Synonyms

NB-3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.145) question?

Stock #

R9698 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

104492790-104863406 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 104833083 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 575 (Y575*)

Ref Sequence

ENSEMBL: ENSMUSP00000086623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]

AlphaFold

Q9JMB8

Predicted Effect

probably null
Transcript: ENSMUST00000089215
AA Change: Y575*

SMART Domains

Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Y575*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000161070
AA Change: Y503*

SMART Domains

Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Y503*

Domain	Start	End	E-Value	Type
SCOP:d1cs6a4	4	40	5e-4	SMART
IG	57	145	2.28e-7	SMART
IGc2	168	232	4e-12	SMART
IGc2	258	321	4.52e-11	SMART
IGc2	350	414	5.48e-10	SMART
IGc2	440	512	1.44e-4	SMART
FN3	526	612	2.17e-11	SMART
FN3	629	715	8.62e0	SMART
FN3	731	816	9.92e-6	SMART
FN3	831	911	8.17e0	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000162872
AA Change: Y575*

SMART Domains

Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Y575*

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
IGc2	41	107	5.24e-7	SMART
IG	129	217	2.28e-7	SMART
IGc2	240	304	4e-12	SMART
IGc2	330	393	4.52e-11	SMART
IGc2	422	486	5.48e-10	SMART
IGc2	512	584	1.44e-4	SMART
FN3	598	684	2.17e-11	SMART
FN3	701	787	8.62e0	SMART
FN3	803	888	9.92e-6	SMART
FN3	903	983	8.17e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc9	T	C	6: 142,626,031	M1124V	probably benign	Het
Adamts9	A	G	6: 92,807,140	C1578R	probably damaging	Het
Adprhl2	T	C	4: 126,316,721	D322G	probably damaging	Het
Anks3	T	C	16: 4,948,249	E327G	probably benign	Het
Aspm	T	G	1: 139,461,908	N689K	probably benign	Het
Bsn	T	A	9: 108,115,971	I861F	probably damaging	Het
Camk2d	C	T	3: 126,840,184	H452Y	possibly damaging	Het
Cerk	T	C	15: 86,142,794	K477E	probably benign	Het
Copg2	T	C	6: 30,861,438	E141G	probably damaging	Het
D430041D05Rik	A	G	2: 104,155,051	S1224P	probably damaging	Het
Dhrs3	T	C	4: 144,919,938	I186T	possibly damaging	Het
Erich2	A	G	2: 70,540,711	D431G	unknown	Het
Fmn2	T	A	1: 174,537,173	C559S	unknown	Het
Gm4858	T	A	3: 93,074,420	D174E	possibly damaging	Het
Gpr180	G	A	14: 118,153,890	G235R	probably damaging	Het
Hoxa13	T	C	6: 52,259,044	T174A	probably benign	Het
Hrh3	A	G	2: 180,101,413	S141P	possibly damaging	Het
Hrnr	T	C	3: 93,325,787	S1111P	unknown	Het
Il12rb1	G	T	8: 70,811,204	Q136H	possibly damaging	Het
Kcna3	T	C	3: 107,037,089	S223P	probably benign	Het
Map10	T	A	8: 125,671,984	N705K	probably benign	Het
Marf1	C	A	16: 14,149,213	V345L	probably benign	Het
Mcub	C	T	3: 129,917,019	D255N	probably damaging	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mroh3	T	C	1: 136,186,714	T625A	probably damaging	Het
Myo18a	A	G	11: 77,829,855	Y1152C	probably damaging	Het
Ncdn	T	C	4: 126,749,895	Y378C	probably damaging	Het
Olfr165	A	T	16: 19,407,592	C141*	probably null	Het
Olfr390	T	C	11: 73,787,616	L226P	probably damaging	Het
Olfr544	G	A	7: 102,484,170	Q317*	probably null	Het
Pcm1	T	C	8: 41,270,504	L342P	possibly damaging	Het
Pdlim1	T	A	19: 40,230,515	D224V	probably benign	Het
Plxnb1	A	G	9: 109,096,183		probably benign	Het
Pot1a	T	C	6: 25,744,616	I630V	probably damaging	Het
Ppil4	A	G	10: 7,807,269		probably null	Het
Ptpru	A	T	4: 131,820,220	I174K	probably benign	Het
Rab11fip4	T	A	11: 79,692,766	L612Q	probably damaging	Het
Rassf4	A	G	6: 116,641,701	L207P	probably damaging	Het
Reg3g	A	C	6: 78,467,822	S58A	probably benign	Het
Ric8b	T	C	10: 84,947,497	L73P	probably damaging	Het
Rmdn2	A	G	17: 79,650,300		probably null	Het
Shank1	G	A	7: 44,312,918	S71N	unknown	Het
Slc46a2	A	G	4: 59,912,582	S397P	probably damaging	Het
Smpd3	A	T	8: 106,265,664	S86T	possibly damaging	Het
Sumf1	T	C	6: 108,154,962	H198R	probably benign	Het
Tagap1	C	G	17: 6,961,078	D18H	probably damaging	Het
Tcf23	C	T	5: 30,968,881	R35C	probably damaging	Het
Tenm3	G	A	8: 48,236,211	L2114F	probably damaging	Het
Ttn	A	T	2: 76,943,374	I2301K	unknown	Het
Ubr4	A	G	4: 139,440,664	E1496G		Het
Usp48	T	C	4: 137,633,891	V756A	possibly damaging	Het
Zfp626	A	G	7: 27,819,015	I474V	possibly damaging	Het
Zfpm1	T	A	8: 122,337,129	S976T	unknown	Het

Other mutations in Cntn6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00547:Cntn6	APN	6	104650400	missense	probably damaging	0.99
IGL01331:Cntn6	APN	6	104774523	missense	probably damaging	1.00
IGL01619:Cntn6	APN	6	104728374	splice site	probably benign
IGL02028:Cntn6	APN	6	104859426	missense	probably damaging	0.99
IGL02420:Cntn6	APN	6	104846142	critical splice donor site	probably null
IGL02557:Cntn6	APN	6	104774535	missense	probably damaging	1.00
IGL03000:Cntn6	APN	6	104804386	missense	probably damaging	1.00
IGL03367:Cntn6	APN	6	104804338	missense	probably damaging	1.00
IGL03383:Cntn6	APN	6	104776457	splice site	probably benign
PIT4366001:Cntn6	UTSW	6	104832537	missense	probably benign	0.05
R0490:Cntn6	UTSW	6	104833918	missense	possibly damaging	0.91
R0583:Cntn6	UTSW	6	104776314	missense	possibly damaging	0.79
R0636:Cntn6	UTSW	6	104863148	missense	probably benign	0.00
R0654:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R0960:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R1241:Cntn6	UTSW	6	104832509	missense	probably damaging	1.00
R1385:Cntn6	UTSW	6	104861900	missense	probably benign	0.07
R1401:Cntn6	UTSW	6	104804398	missense	possibly damaging	0.65
R1478:Cntn6	UTSW	6	104776428	missense	probably benign	0.00
R1542:Cntn6	UTSW	6	104848100	missense	probably damaging	1.00
R1593:Cntn6	UTSW	6	104832580	missense	possibly damaging	0.58
R1840:Cntn6	UTSW	6	104774480	missense	probably damaging	1.00
R2066:Cntn6	UTSW	6	104861822	nonsense	probably null
R2097:Cntn6	UTSW	6	104861949	missense	probably damaging	0.99
R2289:Cntn6	UTSW	6	104569028	start gained	probably benign
R2429:Cntn6	UTSW	6	104650565	missense	possibly damaging	0.96
R2967:Cntn6	UTSW	6	104726237	missense	probably benign	0.04
R4009:Cntn6	UTSW	6	104833822	missense	probably damaging	0.98
R4476:Cntn6	UTSW	6	104772561	missense	probably damaging	1.00
R4664:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4666:Cntn6	UTSW	6	104728284	missense	probably benign	0.20
R4701:Cntn6	UTSW	6	104804360	missense	probably benign	0.01
R4780:Cntn6	UTSW	6	104845784	missense	probably damaging	1.00
R4854:Cntn6	UTSW	6	104859475	missense	possibly damaging	0.95
R4965:Cntn6	UTSW	6	104774474	missense	probably damaging	0.99
R5051:Cntn6	UTSW	6	104772597	missense	probably damaging	1.00
R5075:Cntn6	UTSW	6	104833030	missense	probably damaging	1.00
R5152:Cntn6	UTSW	6	104569113	intron	probably benign
R5291:Cntn6	UTSW	6	104726135	missense	probably damaging	1.00
R5388:Cntn6	UTSW	6	104832562	missense	probably damaging	1.00
R5852:Cntn6	UTSW	6	104835745	missense	probably damaging	0.97
R5937:Cntn6	UTSW	6	104833103	missense	possibly damaging	0.68
R5980:Cntn6	UTSW	6	104848132	missense	probably damaging	0.98
R6290:Cntn6	UTSW	6	104767890	missense	probably damaging	1.00
R6338:Cntn6	UTSW	6	104726139	missense	probably damaging	1.00
R6396:Cntn6	UTSW	6	104650500	missense	probably damaging	1.00
R6447:Cntn6	UTSW	6	104859448	missense	probably damaging	1.00
R6860:Cntn6	UTSW	6	104861946	missense	possibly damaging	0.95
R6871:Cntn6	UTSW	6	104845758	frame shift	probably null
R7012:Cntn6	UTSW	6	104726262	missense	probably damaging	0.98
R7012:Cntn6	UTSW	6	104774480	missense	probably benign	0.01
R7337:Cntn6	UTSW	6	104650530	missense	probably damaging	0.99
R7658:Cntn6	UTSW	6	104650483	missense	probably benign	0.29
R8133:Cntn6	UTSW	6	104728337	missense	probably benign	0.19
R8463:Cntn6	UTSW	6	104772619	missense	possibly damaging	0.64
R8909:Cntn6	UTSW	6	104848132	missense	probably benign	0.05
R9232:Cntn6	UTSW	6	104838820	missense	probably damaging	1.00
R9287:Cntn6	UTSW	6	104832510	missense	possibly damaging	0.89
R9454:Cntn6	UTSW	6	104804347	missense	possibly damaging	0.82
X0020:Cntn6	UTSW	6	104767884	missense	probably benign	0.00
Z1177:Cntn6	UTSW	6	104832584	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTGGTTTTCTGGATGCAATTAGAG -3'
(R):5'- GGAACTGGAACTATTTGCTAAGCAC -3'

Sequencing Primer
(F):5'- TTCTGGATGCAATTAGAGTAAAAGG -3'
(R):5'- GCGAAAAAGTTATGGTTTTCTCTC -3'

Posted On

2022-10-06