Incidental Mutation 'R9698:Cntn6'
ID 729430
Institutional Source Beutler Lab
Gene Symbol Cntn6
Ensembl Gene ENSMUSG00000030092
Gene Name contactin 6
Synonyms NB-3
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.141) question?
Stock # R9698 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 104469751-104840367 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 104810044 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 575 (Y575*)
Ref Sequence ENSEMBL: ENSMUSP00000086623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089215] [ENSMUST00000161070] [ENSMUST00000162872]
AlphaFold Q9JMB8
Predicted Effect probably null
Transcript: ENSMUST00000089215
AA Change: Y575*
SMART Domains Protein: ENSMUSP00000086623
Gene: ENSMUSG00000030092
AA Change: Y575*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161070
AA Change: Y503*
SMART Domains Protein: ENSMUSP00000124714
Gene: ENSMUSG00000030092
AA Change: Y503*

DomainStartEndE-ValueType
SCOP:d1cs6a4 4 40 5e-4 SMART
IG 57 145 2.28e-7 SMART
IGc2 168 232 4e-12 SMART
IGc2 258 321 4.52e-11 SMART
IGc2 350 414 5.48e-10 SMART
IGc2 440 512 1.44e-4 SMART
FN3 526 612 2.17e-11 SMART
FN3 629 715 8.62e0 SMART
FN3 731 816 9.92e-6 SMART
FN3 831 911 8.17e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162872
AA Change: Y575*
SMART Domains Protein: ENSMUSP00000124025
Gene: ENSMUSG00000030092
AA Change: Y575*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGc2 41 107 5.24e-7 SMART
IG 129 217 2.28e-7 SMART
IGc2 240 304 4e-12 SMART
IGc2 330 393 4.52e-11 SMART
IGc2 422 486 5.48e-10 SMART
IGc2 512 584 1.44e-4 SMART
FN3 598 684 2.17e-11 SMART
FN3 701 787 8.62e0 SMART
FN3 803 888 9.92e-6 SMART
FN3 903 983 8.17e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. It is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display impaired coordination without any obvious morphological of physiological abnormalities in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,571,757 (GRCm39) M1124V probably benign Het
Adamts9 A G 6: 92,784,121 (GRCm39) C1578R probably damaging Het
Adprs T C 4: 126,210,514 (GRCm39) D322G probably damaging Het
Anks3 T C 16: 4,766,113 (GRCm39) E327G probably benign Het
Aspm T G 1: 139,389,646 (GRCm39) N689K probably benign Het
Bsn T A 9: 107,993,170 (GRCm39) I861F probably damaging Het
Camk2d C T 3: 126,633,833 (GRCm39) H452Y possibly damaging Het
Cerk T C 15: 86,026,995 (GRCm39) K477E probably benign Het
Copg2 T C 6: 30,838,373 (GRCm39) E141G probably damaging Het
D430041D05Rik A G 2: 103,985,396 (GRCm39) S1224P probably damaging Het
Dhrs3 T C 4: 144,646,508 (GRCm39) I186T possibly damaging Het
Erich2 A G 2: 70,371,055 (GRCm39) D431G unknown Het
Fmn2 T A 1: 174,364,739 (GRCm39) C559S unknown Het
Gpr180 G A 14: 118,391,302 (GRCm39) G235R probably damaging Het
Hoxa13 T C 6: 52,236,024 (GRCm39) T174A probably benign Het
Hrh3 A G 2: 179,743,206 (GRCm39) S141P possibly damaging Het
Hrnr T C 3: 93,233,094 (GRCm39) S1111P unknown Het
Il12rb1 G T 8: 71,263,848 (GRCm39) Q136H possibly damaging Het
Kcna3 T C 3: 106,944,405 (GRCm39) S223P probably benign Het
Map10 T A 8: 126,398,723 (GRCm39) N705K probably benign Het
Marf1 C A 16: 13,967,077 (GRCm39) V345L probably benign Het
Mcub C T 3: 129,710,668 (GRCm39) D255N probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mroh3 T C 1: 136,114,452 (GRCm39) T625A probably damaging Het
Myo18a A G 11: 77,720,681 (GRCm39) Y1152C probably damaging Het
Ncdn T C 4: 126,643,688 (GRCm39) Y378C probably damaging Het
Or1e30 T C 11: 73,678,442 (GRCm39) L226P probably damaging Het
Or2m13 A T 16: 19,226,342 (GRCm39) C141* probably null Het
Or55b4 G A 7: 102,133,377 (GRCm39) Q317* probably null Het
Pcm1 T C 8: 41,723,541 (GRCm39) L342P possibly damaging Het
Pdlim1 T A 19: 40,218,959 (GRCm39) D224V probably benign Het
Plxnb1 A G 9: 108,925,251 (GRCm39) probably benign Het
Pot1a T C 6: 25,744,615 (GRCm39) I630V probably damaging Het
Ppil4 A G 10: 7,683,033 (GRCm39) probably null Het
Ptpru A T 4: 131,547,531 (GRCm39) I174K probably benign Het
Rab11fip4 T A 11: 79,583,592 (GRCm39) L612Q probably damaging Het
Rassf4 A G 6: 116,618,662 (GRCm39) L207P probably damaging Het
Reg3g A C 6: 78,444,805 (GRCm39) S58A probably benign Het
Ric8b T C 10: 84,783,361 (GRCm39) L73P probably damaging Het
Rmdn2 A G 17: 79,957,729 (GRCm39) probably null Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc46a2 A G 4: 59,912,582 (GRCm39) S397P probably damaging Het
Smpd3 A T 8: 106,992,296 (GRCm39) S86T possibly damaging Het
Sumf1 T C 6: 108,131,923 (GRCm39) H198R probably benign Het
Tagap1 C G 17: 7,228,477 (GRCm39) D18H probably damaging Het
Tcf23 C T 5: 31,126,225 (GRCm39) R35C probably damaging Het
Tdpoz8 T A 3: 92,981,727 (GRCm39) D174E possibly damaging Het
Tenm3 G A 8: 48,689,246 (GRCm39) L2114F probably damaging Het
Ttn A T 2: 76,773,718 (GRCm39) I2301K unknown Het
Ubr4 A G 4: 139,167,975 (GRCm39) E1496G Het
Usp48 T C 4: 137,361,202 (GRCm39) V756A possibly damaging Het
Zfp626 A G 7: 27,518,440 (GRCm39) I474V possibly damaging Het
Zfpm1 T A 8: 123,063,868 (GRCm39) S976T unknown Het
Other mutations in Cntn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Cntn6 APN 6 104,627,361 (GRCm39) missense probably damaging 0.99
IGL01331:Cntn6 APN 6 104,751,484 (GRCm39) missense probably damaging 1.00
IGL01619:Cntn6 APN 6 104,705,335 (GRCm39) splice site probably benign
IGL02028:Cntn6 APN 6 104,836,387 (GRCm39) missense probably damaging 0.99
IGL02420:Cntn6 APN 6 104,823,103 (GRCm39) critical splice donor site probably null
IGL02557:Cntn6 APN 6 104,751,496 (GRCm39) missense probably damaging 1.00
IGL03000:Cntn6 APN 6 104,781,347 (GRCm39) missense probably damaging 1.00
IGL03367:Cntn6 APN 6 104,781,299 (GRCm39) missense probably damaging 1.00
IGL03383:Cntn6 APN 6 104,753,418 (GRCm39) splice site probably benign
PIT4366001:Cntn6 UTSW 6 104,809,498 (GRCm39) missense probably benign 0.05
R0490:Cntn6 UTSW 6 104,810,879 (GRCm39) missense possibly damaging 0.91
R0583:Cntn6 UTSW 6 104,753,275 (GRCm39) missense possibly damaging 0.79
R0636:Cntn6 UTSW 6 104,840,109 (GRCm39) missense probably benign 0.00
R0654:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R0960:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R1241:Cntn6 UTSW 6 104,809,470 (GRCm39) missense probably damaging 1.00
R1385:Cntn6 UTSW 6 104,838,861 (GRCm39) missense probably benign 0.07
R1401:Cntn6 UTSW 6 104,781,359 (GRCm39) missense possibly damaging 0.65
R1478:Cntn6 UTSW 6 104,753,389 (GRCm39) missense probably benign 0.00
R1542:Cntn6 UTSW 6 104,825,061 (GRCm39) missense probably damaging 1.00
R1593:Cntn6 UTSW 6 104,809,541 (GRCm39) missense possibly damaging 0.58
R1840:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably damaging 1.00
R2066:Cntn6 UTSW 6 104,838,783 (GRCm39) nonsense probably null
R2097:Cntn6 UTSW 6 104,838,910 (GRCm39) missense probably damaging 0.99
R2289:Cntn6 UTSW 6 104,545,989 (GRCm39) start gained probably benign
R2429:Cntn6 UTSW 6 104,627,526 (GRCm39) missense possibly damaging 0.96
R2967:Cntn6 UTSW 6 104,703,198 (GRCm39) missense probably benign 0.04
R4009:Cntn6 UTSW 6 104,810,783 (GRCm39) missense probably damaging 0.98
R4476:Cntn6 UTSW 6 104,749,522 (GRCm39) missense probably damaging 1.00
R4664:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4666:Cntn6 UTSW 6 104,705,245 (GRCm39) missense probably benign 0.20
R4701:Cntn6 UTSW 6 104,781,321 (GRCm39) missense probably benign 0.01
R4780:Cntn6 UTSW 6 104,822,745 (GRCm39) missense probably damaging 1.00
R4854:Cntn6 UTSW 6 104,836,436 (GRCm39) missense possibly damaging 0.95
R4965:Cntn6 UTSW 6 104,751,435 (GRCm39) missense probably damaging 0.99
R5051:Cntn6 UTSW 6 104,749,558 (GRCm39) missense probably damaging 1.00
R5075:Cntn6 UTSW 6 104,809,991 (GRCm39) missense probably damaging 1.00
R5152:Cntn6 UTSW 6 104,546,074 (GRCm39) intron probably benign
R5291:Cntn6 UTSW 6 104,703,096 (GRCm39) missense probably damaging 1.00
R5388:Cntn6 UTSW 6 104,809,523 (GRCm39) missense probably damaging 1.00
R5852:Cntn6 UTSW 6 104,812,706 (GRCm39) missense probably damaging 0.97
R5937:Cntn6 UTSW 6 104,810,064 (GRCm39) missense possibly damaging 0.68
R5980:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably damaging 0.98
R6290:Cntn6 UTSW 6 104,744,851 (GRCm39) missense probably damaging 1.00
R6338:Cntn6 UTSW 6 104,703,100 (GRCm39) missense probably damaging 1.00
R6396:Cntn6 UTSW 6 104,627,461 (GRCm39) missense probably damaging 1.00
R6447:Cntn6 UTSW 6 104,836,409 (GRCm39) missense probably damaging 1.00
R6860:Cntn6 UTSW 6 104,838,907 (GRCm39) missense possibly damaging 0.95
R6871:Cntn6 UTSW 6 104,822,719 (GRCm39) frame shift probably null
R7012:Cntn6 UTSW 6 104,751,441 (GRCm39) missense probably benign 0.01
R7012:Cntn6 UTSW 6 104,703,223 (GRCm39) missense probably damaging 0.98
R7337:Cntn6 UTSW 6 104,627,491 (GRCm39) missense probably damaging 0.99
R7658:Cntn6 UTSW 6 104,627,444 (GRCm39) missense probably benign 0.29
R8133:Cntn6 UTSW 6 104,705,298 (GRCm39) missense probably benign 0.19
R8463:Cntn6 UTSW 6 104,749,580 (GRCm39) missense possibly damaging 0.64
R8909:Cntn6 UTSW 6 104,825,093 (GRCm39) missense probably benign 0.05
R9232:Cntn6 UTSW 6 104,815,781 (GRCm39) missense probably damaging 1.00
R9287:Cntn6 UTSW 6 104,809,471 (GRCm39) missense possibly damaging 0.89
R9454:Cntn6 UTSW 6 104,781,308 (GRCm39) missense possibly damaging 0.82
X0020:Cntn6 UTSW 6 104,744,845 (GRCm39) missense probably benign 0.00
Z1177:Cntn6 UTSW 6 104,809,545 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGTTTTCTGGATGCAATTAGAG -3'
(R):5'- GGAACTGGAACTATTTGCTAAGCAC -3'

Sequencing Primer
(F):5'- TTCTGGATGCAATTAGAGTAAAAGG -3'
(R):5'- GCGAAAAAGTTATGGTTTTCTCTC -3'
Posted On 2022-10-06