Incidental Mutation 'R9699:Dock8'
ID 729493
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms 1200017A24Rik, 5830472H07Rik, A130095G14Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.083) question?
Stock # R9699 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 24976898-25179796 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 25133388 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025831
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik G T 1: 57,416,927 (GRCm39) R33L probably benign Het
Abhd16b A T 2: 181,136,518 (GRCm39) R473S probably benign Het
Adcyap1r1 A G 6: 55,474,140 (GRCm39) D492G probably damaging Het
Ano5 A T 7: 51,229,309 (GRCm39) N617I probably damaging Het
Cdh15 A G 8: 123,588,769 (GRCm39) E281G probably benign Het
Clasp2 T A 9: 113,738,614 (GRCm39) probably null Het
Dscaml1 T C 9: 45,654,315 (GRCm39) V1449A probably damaging Het
Ercc6 A G 14: 32,282,703 (GRCm39) D732G probably damaging Het
Fam174c T A 10: 80,010,161 (GRCm39) probably null Het
Fhip2b A T 14: 70,825,179 (GRCm39) S386T possibly damaging Het
Gimap6 T C 6: 48,684,951 (GRCm39) E45G probably benign Het
Glt1d1 C A 5: 127,771,364 (GRCm39) T285K probably damaging Het
Gm14412 A T 2: 177,007,636 (GRCm39) Y86* probably null Het
Grip2 A G 6: 91,742,318 (GRCm39) S912P probably benign Het
Gucy2d T A 7: 98,108,290 (GRCm39) I741N probably damaging Het
Hrh2 A T 13: 54,368,299 (GRCm39) N92Y probably damaging Het
Klrc2 T A 6: 129,637,452 (GRCm39) Q23L possibly damaging Het
Patl2 T C 2: 121,955,591 (GRCm39) D285G probably damaging Het
Prpf40a A G 2: 53,035,735 (GRCm39) V685A probably benign Het
Rspry1 A G 8: 95,380,857 (GRCm39) H511R probably benign Het
Scarb1 G T 5: 125,374,296 (GRCm39) A279E probably damaging Het
Sell A G 1: 163,893,114 (GRCm39) E110G probably damaging Het
Sftpc A T 14: 70,760,143 (GRCm39) I38N probably damaging Het
Shank1 G A 7: 43,962,342 (GRCm39) S71N unknown Het
Slc5a4b C A 10: 75,946,674 (GRCm39) V33F probably damaging Het
Smad7 A G 18: 75,527,161 (GRCm39) S336G probably damaging Het
Tnpo3 C T 6: 29,565,768 (GRCm39) V529I probably benign Het
Trafd1 A G 5: 121,517,727 (GRCm39) V22A probably benign Het
Tssk1 A G 16: 17,712,545 (GRCm39) E110G probably damaging Het
Vmn1r159 A T 7: 22,542,675 (GRCm39) V119D probably damaging Het
Vmn1r191 A G 13: 22,363,355 (GRCm39) F133S probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp830 C T 11: 82,655,805 (GRCm39) T203I possibly damaging Het
Zw10 G T 9: 48,966,942 (GRCm39) probably benign Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25,105,076 (GRCm39) critical splice donor site probably benign
primurus APN 19 25,160,973 (GRCm39) missense probably damaging 1.00
IGL00737:Dock8 APN 19 25,160,340 (GRCm39) missense probably benign 0.00
IGL00755:Dock8 APN 19 25,028,873 (GRCm39) missense probably benign 0.09
IGL00822:Dock8 APN 19 25,165,773 (GRCm39) nonsense probably null
IGL00838:Dock8 APN 19 25,152,823 (GRCm39) nonsense probably null
IGL01419:Dock8 APN 19 25,096,816 (GRCm39) missense probably benign 0.08
IGL01456:Dock8 APN 19 25,096,863 (GRCm39) missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25,146,805 (GRCm39) missense probably damaging 0.99
IGL01602:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01605:Dock8 APN 19 25,067,252 (GRCm39) splice site probably benign
IGL01753:Dock8 APN 19 25,038,656 (GRCm39) splice site probably benign
IGL01843:Dock8 APN 19 25,067,292 (GRCm39) missense probably benign 0.02
IGL02032:Dock8 APN 19 25,107,769 (GRCm39) missense probably damaging 0.99
IGL02073:Dock8 APN 19 25,178,350 (GRCm39) critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25,055,569 (GRCm39) critical splice donor site probably null
IGL02402:Dock8 APN 19 25,055,509 (GRCm39) missense probably benign 0.25
IGL02529:Dock8 APN 19 25,078,290 (GRCm39) nonsense probably null
IGL02728:Dock8 APN 19 25,109,584 (GRCm39) missense probably benign
IGL02739:Dock8 APN 19 25,165,852 (GRCm39) missense probably damaging 1.00
IGL03037:Dock8 APN 19 25,063,545 (GRCm39) missense probably benign 0.02
IGL03104:Dock8 APN 19 25,178,384 (GRCm39) nonsense probably null
IGL03137:Dock8 APN 19 25,133,312 (GRCm39) missense probably benign 0.19
IGL03365:Dock8 APN 19 25,077,048 (GRCm39) missense possibly damaging 0.70
Defenseless UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
Guardate UTSW 19 25,127,195 (GRCm39) missense probably benign
hillock UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
Molehill UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
Pap UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
Papilla UTSW 19 25,055,448 (GRCm39) nonsense probably null
snowdrop UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
warts_and_all UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R0021:Dock8 UTSW 19 25,140,411 (GRCm39) missense probably benign 0.01
R0147:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0148:Dock8 UTSW 19 25,096,823 (GRCm39) missense probably benign 0.00
R0294:Dock8 UTSW 19 25,165,714 (GRCm39) missense probably damaging 1.00
R0537:Dock8 UTSW 19 25,148,941 (GRCm39) missense probably benign 0.08
R0630:Dock8 UTSW 19 25,038,524 (GRCm39) missense probably benign 0.10
R1163:Dock8 UTSW 19 25,028,867 (GRCm39) missense probably benign
R1164:Dock8 UTSW 19 25,067,391 (GRCm39) missense probably benign 0.44
R1471:Dock8 UTSW 19 25,178,400 (GRCm39) missense possibly damaging 0.74
R1477:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R1633:Dock8 UTSW 19 25,028,927 (GRCm39) missense probably benign 0.00
R1803:Dock8 UTSW 19 25,109,599 (GRCm39) missense probably benign 0.00
R1822:Dock8 UTSW 19 25,138,422 (GRCm39) missense probably benign 0.31
R1852:Dock8 UTSW 19 25,104,492 (GRCm39) missense probably benign 0.45
R1916:Dock8 UTSW 19 25,038,521 (GRCm39) missense probably benign 0.02
R1984:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R2311:Dock8 UTSW 19 25,160,368 (GRCm39) missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25,177,757 (GRCm39) missense probably damaging 0.99
R2483:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3116:Dock8 UTSW 19 25,165,858 (GRCm39) missense probably benign 0.00
R3157:Dock8 UTSW 19 25,127,195 (GRCm39) missense probably benign
R3623:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3624:Dock8 UTSW 19 25,057,241 (GRCm39) missense probably benign
R3800:Dock8 UTSW 19 25,141,716 (GRCm39) missense probably benign 0.08
R3844:Dock8 UTSW 19 25,042,794 (GRCm39) nonsense probably null
R3895:Dock8 UTSW 19 25,028,865 (GRCm39) missense probably benign 0.31
R3901:Dock8 UTSW 19 25,078,269 (GRCm39) missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25,162,305 (GRCm39) critical splice donor site probably null
R4428:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4428:Dock8 UTSW 19 25,177,863 (GRCm39) missense probably damaging 0.98
R4429:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4431:Dock8 UTSW 19 25,042,754 (GRCm39) missense probably benign 0.00
R4545:Dock8 UTSW 19 25,165,722 (GRCm39) missense probably damaging 1.00
R4839:Dock8 UTSW 19 25,146,858 (GRCm39) missense probably benign 0.00
R4897:Dock8 UTSW 19 25,159,001 (GRCm39) missense probably benign 0.00
R4939:Dock8 UTSW 19 25,099,764 (GRCm39) missense probably damaging 1.00
R4995:Dock8 UTSW 19 25,135,747 (GRCm39) missense probably benign 0.02
R5035:Dock8 UTSW 19 25,063,571 (GRCm39) missense probably damaging 0.99
R5294:Dock8 UTSW 19 25,038,517 (GRCm39) missense probably benign 0.01
R5324:Dock8 UTSW 19 25,140,458 (GRCm39) missense probably benign 0.17
R5478:Dock8 UTSW 19 25,057,186 (GRCm39) missense probably benign
R5704:Dock8 UTSW 19 25,151,586 (GRCm39) missense probably damaging 1.00
R5724:Dock8 UTSW 19 25,099,785 (GRCm39) missense probably damaging 1.00
R5745:Dock8 UTSW 19 25,107,761 (GRCm39) missense probably benign 0.02
R5864:Dock8 UTSW 19 25,038,584 (GRCm39) missense probably damaging 0.99
R5870:Dock8 UTSW 19 25,109,490 (GRCm39) missense probably benign
R5893:Dock8 UTSW 19 25,099,811 (GRCm39) missense probably damaging 1.00
R5954:Dock8 UTSW 19 25,148,983 (GRCm39) missense probably damaging 1.00
R6087:Dock8 UTSW 19 25,138,438 (GRCm39) missense probably benign 0.00
R6223:Dock8 UTSW 19 25,138,416 (GRCm39) missense probably benign 0.00
R6391:Dock8 UTSW 19 25,072,914 (GRCm39) missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25,104,848 (GRCm39) missense probably damaging 0.99
R6786:Dock8 UTSW 19 25,160,386 (GRCm39) missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25,099,805 (GRCm39) missense probably benign 0.31
R6818:Dock8 UTSW 19 25,146,865 (GRCm39) critical splice donor site probably null
R6885:Dock8 UTSW 19 25,124,742 (GRCm39) missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25,165,746 (GRCm39) missense probably damaging 1.00
R6923:Dock8 UTSW 19 25,072,970 (GRCm39) missense probably benign
R7001:Dock8 UTSW 19 25,077,041 (GRCm39) missense probably benign
R7141:Dock8 UTSW 19 25,158,984 (GRCm39) missense probably null 0.75
R7203:Dock8 UTSW 19 25,158,927 (GRCm39) missense probably damaging 1.00
R7257:Dock8 UTSW 19 25,104,449 (GRCm39) missense probably benign 0.08
R7296:Dock8 UTSW 19 25,162,245 (GRCm39) missense probably benign 0.00
R7538:Dock8 UTSW 19 25,135,782 (GRCm39) missense probably damaging 1.00
R7555:Dock8 UTSW 19 25,152,764 (GRCm39) missense probably damaging 0.99
R7641:Dock8 UTSW 19 25,151,697 (GRCm39) critical splice donor site probably null
R7764:Dock8 UTSW 19 25,074,899 (GRCm39) missense probably benign
R7859:Dock8 UTSW 19 25,160,934 (GRCm39) missense probably damaging 1.00
R7864:Dock8 UTSW 19 25,140,864 (GRCm39) missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25,131,606 (GRCm39) missense probably damaging 1.00
R8160:Dock8 UTSW 19 25,124,711 (GRCm39) missense probably damaging 1.00
R8287:Dock8 UTSW 19 25,107,825 (GRCm39) missense probably damaging 1.00
R8295:Dock8 UTSW 19 25,100,600 (GRCm39) missense probably benign 0.04
R8443:Dock8 UTSW 19 25,133,281 (GRCm39) missense probably benign 0.04
R8537:Dock8 UTSW 19 25,107,870 (GRCm39) missense probably benign 0.00
R8673:Dock8 UTSW 19 25,160,867 (GRCm39) missense probably damaging 0.96
R8709:Dock8 UTSW 19 25,055,448 (GRCm39) nonsense probably null
R8834:Dock8 UTSW 19 25,140,834 (GRCm39) missense probably benign 0.16
R8991:Dock8 UTSW 19 25,165,731 (GRCm39) missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25,160,995 (GRCm39) splice site probably benign
R9509:Dock8 UTSW 19 25,072,985 (GRCm39) missense probably benign 0.00
R9526:Dock8 UTSW 19 25,165,739 (GRCm39) missense probably benign 0.10
R9622:Dock8 UTSW 19 25,098,545 (GRCm39) missense probably null
R9634:Dock8 UTSW 19 25,169,585 (GRCm39) missense probably damaging 1.00
R9654:Dock8 UTSW 19 25,124,710 (GRCm39) missense probably damaging 1.00
R9670:Dock8 UTSW 19 25,148,926 (GRCm39) missense probably null 0.01
R9726:Dock8 UTSW 19 25,154,374 (GRCm39) missense probably damaging 0.97
R9765:Dock8 UTSW 19 25,146,832 (GRCm39) missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25,138,493 (GRCm39) missense probably benign
Z1177:Dock8 UTSW 19 25,133,336 (GRCm39) missense probably benign 0.16
Z1177:Dock8 UTSW 19 25,109,487 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTCCGTAAATGCAAGCCAGC -3'
(R):5'- ATGGATCTTCTAATCACCTTGCCTCT -3'

Sequencing Primer
(F):5'- CAAGCCAGCACTGTTTTAATTCCAG -3'
(R):5'- GCCTCTCTATACTCCACCAGTAC -3'
Posted On 2022-10-06