Incidental Mutation 'R9702:Pign'
ID 729605
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Name phosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.838) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 105446147-105591402 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 105485212 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 782 (D782E)
Ref Sequence ENSEMBL: ENSMUSP00000139638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000190811]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000070699
AA Change: D782E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536
AA Change: D782E

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186485
AA Change: D782E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536
AA Change: D782E

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187537
AA Change: D782E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536
AA Change: D782E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190811
AA Change: D782E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536
AA Change: D782E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105,525,448 (GRCm39) nonsense probably null
IGL00770:Pign APN 1 105,525,481 (GRCm39) missense probably benign 0.00
IGL00774:Pign APN 1 105,525,481 (GRCm39) missense probably benign 0.00
IGL00828:Pign APN 1 105,481,845 (GRCm39) missense probably damaging 0.97
IGL01407:Pign APN 1 105,517,027 (GRCm39) missense probably benign 0.06
IGL01523:Pign APN 1 105,580,903 (GRCm39) missense probably damaging 0.98
IGL01953:Pign APN 1 105,516,764 (GRCm39) splice site probably benign
IGL02389:Pign APN 1 105,574,506 (GRCm39) nonsense probably null
PIT4810001:Pign UTSW 1 105,525,487 (GRCm39) missense possibly damaging 0.83
R0080:Pign UTSW 1 105,480,130 (GRCm39) missense probably damaging 1.00
R0097:Pign UTSW 1 105,515,701 (GRCm39) splice site probably benign
R0302:Pign UTSW 1 105,516,818 (GRCm39) missense possibly damaging 0.83
R0573:Pign UTSW 1 105,580,902 (GRCm39) missense probably damaging 1.00
R0580:Pign UTSW 1 105,519,419 (GRCm39) missense probably benign 0.03
R0946:Pign UTSW 1 105,519,422 (GRCm39) missense probably benign 0.00
R1397:Pign UTSW 1 105,585,496 (GRCm39) missense probably damaging 1.00
R1462:Pign UTSW 1 105,512,727 (GRCm39) missense possibly damaging 0.95
R1462:Pign UTSW 1 105,512,727 (GRCm39) missense possibly damaging 0.95
R1751:Pign UTSW 1 105,580,917 (GRCm39) missense probably benign 0.19
R1753:Pign UTSW 1 105,517,042 (GRCm39) missense possibly damaging 0.65
R1767:Pign UTSW 1 105,580,917 (GRCm39) missense probably benign 0.19
R1854:Pign UTSW 1 105,482,223 (GRCm39) missense probably damaging 0.99
R1907:Pign UTSW 1 105,565,940 (GRCm39) missense possibly damaging 0.50
R2845:Pign UTSW 1 105,585,521 (GRCm39) missense possibly damaging 0.80
R2846:Pign UTSW 1 105,585,521 (GRCm39) missense possibly damaging 0.80
R3718:Pign UTSW 1 105,577,006 (GRCm39) critical splice donor site probably null
R3970:Pign UTSW 1 105,583,728 (GRCm39) missense probably damaging 1.00
R4067:Pign UTSW 1 105,515,703 (GRCm39) critical splice donor site probably null
R4110:Pign UTSW 1 105,481,540 (GRCm39) unclassified probably benign
R4387:Pign UTSW 1 105,449,785 (GRCm39) missense possibly damaging 0.48
R4393:Pign UTSW 1 105,449,751 (GRCm39) missense probably benign 0.00
R4472:Pign UTSW 1 105,575,945 (GRCm39) missense probably benign 0.29
R4519:Pign UTSW 1 105,525,391 (GRCm39) critical splice donor site probably null
R4619:Pign UTSW 1 105,449,715 (GRCm39) utr 3 prime probably benign
R4746:Pign UTSW 1 105,512,749 (GRCm39) missense probably benign 0.33
R4859:Pign UTSW 1 105,575,892 (GRCm39) nonsense probably null
R4893:Pign UTSW 1 105,574,436 (GRCm39) missense probably damaging 1.00
R4953:Pign UTSW 1 105,572,227 (GRCm39) missense probably benign 0.32
R5046:Pign UTSW 1 105,449,798 (GRCm39) missense possibly damaging 0.94
R5377:Pign UTSW 1 105,585,537 (GRCm39) missense probably benign 0.12
R5388:Pign UTSW 1 105,583,695 (GRCm39) missense probably damaging 1.00
R5482:Pign UTSW 1 105,474,435 (GRCm39) missense probably benign 0.44
R5594:Pign UTSW 1 105,574,594 (GRCm39) intron probably benign
R5639:Pign UTSW 1 105,517,040 (GRCm39) missense probably benign 0.09
R5778:Pign UTSW 1 105,519,447 (GRCm39) missense probably damaging 1.00
R5821:Pign UTSW 1 105,516,788 (GRCm39) missense possibly damaging 0.95
R5928:Pign UTSW 1 105,485,792 (GRCm39) missense possibly damaging 0.55
R5979:Pign UTSW 1 105,516,999 (GRCm39) missense probably benign 0.01
R6213:Pign UTSW 1 105,516,991 (GRCm39) missense possibly damaging 0.50
R6292:Pign UTSW 1 105,512,802 (GRCm39) missense possibly damaging 0.69
R6343:Pign UTSW 1 105,512,820 (GRCm39) missense probably benign 0.33
R6566:Pign UTSW 1 105,565,906 (GRCm39) critical splice donor site probably null
R6856:Pign UTSW 1 105,481,620 (GRCm39) nonsense probably null
R6954:Pign UTSW 1 105,481,622 (GRCm39) missense probably benign 0.39
R7361:Pign UTSW 1 105,512,778 (GRCm39) missense probably benign 0.01
R7582:Pign UTSW 1 105,577,092 (GRCm39) missense probably benign 0.00
R7622:Pign UTSW 1 105,575,842 (GRCm39) missense possibly damaging 0.65
R7742:Pign UTSW 1 105,480,122 (GRCm39) missense probably benign
R7892:Pign UTSW 1 105,585,401 (GRCm39) missense probably benign 0.01
R8273:Pign UTSW 1 105,516,803 (GRCm39) missense probably benign 0.00
R8352:Pign UTSW 1 105,575,917 (GRCm39) missense probably benign 0.35
R8452:Pign UTSW 1 105,575,917 (GRCm39) missense probably benign 0.35
R8826:Pign UTSW 1 105,481,827 (GRCm39) missense probably damaging 1.00
R8841:Pign UTSW 1 105,485,634 (GRCm39) intron probably benign
R8886:Pign UTSW 1 105,512,779 (GRCm39) missense probably benign
R8904:Pign UTSW 1 105,519,359 (GRCm39) missense possibly damaging 0.87
R9074:Pign UTSW 1 105,556,246 (GRCm39) missense unknown
R9197:Pign UTSW 1 105,516,818 (GRCm39) missense probably benign 0.03
R9630:Pign UTSW 1 105,481,591 (GRCm39) missense probably benign 0.23
X0025:Pign UTSW 1 105,585,359 (GRCm39) missense probably benign 0.03
Z1177:Pign UTSW 1 105,585,545 (GRCm39) start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- GAGAACTATGCATGTGGAAAACTC -3'
(R):5'- GCACCATAACTCCATTGAGCATG -3'

Sequencing Primer
(F):5'- TGCATGTGGAAAACTCAAGTTG -3'
(R):5'- AACTCCATTGAGCATGTTACTAAC -3'
Posted On 2022-10-06