Incidental Mutation 'R9702:Cd84'
ID 729606
Institutional Source Beutler Lab
Gene Symbol Cd84
Ensembl Gene ENSMUSG00000038147
Gene Name CD84 antigen
Synonyms SLAMF5, CDw84, A130013D22Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 171667265-171718285 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 171700498 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 205 (V205A)
Ref Sequence ENSEMBL: ENSMUSP00000047024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042302] [ENSMUST00000136479] [ENSMUST00000155802]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000042302
AA Change: V205A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000047024
Gene: ENSMUSG00000038147
AA Change: V205A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136479
AA Change: V205A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000122951
Gene: ENSMUSG00000038147
AA Change: V205A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155802
AA Change: V205A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000120881
Gene: ENSMUSG00000038147
AA Change: V205A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 26 126 3.16e-1 SMART
IG_like 137 208 1.02e1 SMART
transmembrane domain 220 242 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane glycoprotein that is a member of the signaling lymphocyte activation molecule (SLAM) family. This family forms a subset of the larger CD2 cell-surface receptor Ig superfamily. The encoded protein is a homophilic adhesion molecule that is expressed in numerous immune cells types and is involved in regulating receptor-mediated signaling in those cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele of this gene show defects in T follicular helper function and germinal center formation. Mice homozygous for a different knock-out allele display normal platelet physiology and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Cd84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cd84 APN 1 171,679,704 (GRCm39) critical splice donor site probably null
IGL01371:Cd84 APN 1 171,713,937 (GRCm39) missense probably benign 0.36
IGL03035:Cd84 APN 1 171,679,601 (GRCm39) missense probably damaging 0.99
IGL03098:Cd84 APN 1 171,700,267 (GRCm39) missense possibly damaging 0.78
R0511:Cd84 UTSW 1 171,700,494 (GRCm39) missense probably benign 0.00
R1244:Cd84 UTSW 1 171,679,397 (GRCm39) missense probably damaging 0.99
R1438:Cd84 UTSW 1 171,679,685 (GRCm39) missense probably damaging 1.00
R1459:Cd84 UTSW 1 171,679,510 (GRCm39) missense probably benign 0.02
R1654:Cd84 UTSW 1 171,712,173 (GRCm39) missense possibly damaging 0.69
R1658:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1659:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1765:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1771:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1776:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1799:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1815:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1816:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R1982:Cd84 UTSW 1 171,712,152 (GRCm39) splice site probably null
R1990:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R2056:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R2057:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R2058:Cd84 UTSW 1 171,700,317 (GRCm39) missense possibly damaging 0.78
R2098:Cd84 UTSW 1 171,713,148 (GRCm39) missense probably benign 0.07
R4674:Cd84 UTSW 1 171,700,887 (GRCm39) missense possibly damaging 0.82
R4675:Cd84 UTSW 1 171,700,887 (GRCm39) missense possibly damaging 0.82
R4806:Cd84 UTSW 1 171,679,688 (GRCm39) missense probably benign 0.00
R4828:Cd84 UTSW 1 171,700,315 (GRCm39) missense probably damaging 0.97
R4908:Cd84 UTSW 1 171,700,432 (GRCm39) missense probably damaging 0.96
R5366:Cd84 UTSW 1 171,700,872 (GRCm39) missense probably damaging 1.00
R5725:Cd84 UTSW 1 171,700,928 (GRCm39) missense probably benign 0.00
R5883:Cd84 UTSW 1 171,700,405 (GRCm39) missense possibly damaging 0.58
R6722:Cd84 UTSW 1 171,700,344 (GRCm39) missense probably damaging 0.98
R6966:Cd84 UTSW 1 171,713,976 (GRCm39) missense possibly damaging 0.93
R7513:Cd84 UTSW 1 171,712,185 (GRCm39) missense probably benign 0.01
R7733:Cd84 UTSW 1 171,668,226 (GRCm39) start codon destroyed probably null 1.00
R9123:Cd84 UTSW 1 171,712,153 (GRCm39) critical splice acceptor site probably null
R9134:Cd84 UTSW 1 171,679,413 (GRCm39) missense probably damaging 1.00
R9441:Cd84 UTSW 1 171,713,994 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTAATATCACACTGACATGCTCTG -3'
(R):5'- TCAAAGAGTCAAACAGGGGCTC -3'

Sequencing Primer
(F):5'- CACTGACATGCTCTGTGGAAAAG -3'
(R):5'- CCCTTCATAGAGAAAGCTTTGGTC -3'
Posted On 2022-10-06