Incidental Mutation 'R9702:Bdnf'
ID 729609
Institutional Source Beutler Lab
Gene Symbol Bdnf
Ensembl Gene ENSMUSG00000048482
Gene Name brain derived neurotrophic factor
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.423) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 109505045-109557352 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109554117 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 164 (M164L)
Ref Sequence ENSEMBL: ENSMUSP00000106671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053317] [ENSMUST00000111042] [ENSMUST00000111043] [ENSMUST00000111044] [ENSMUST00000111045] [ENSMUST00000111046] [ENSMUST00000111047] [ENSMUST00000111049] [ENSMUST00000111050] [ENSMUST00000111051] [ENSMUST00000176893]
AlphaFold P21237
Predicted Effect possibly damaging
Transcript: ENSMUST00000053317
AA Change: M132L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057989
Gene: ENSMUSG00000048482
AA Change: M132L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 111 122 N/A INTRINSIC
NGF 143 250 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111042
AA Change: M164L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106671
Gene: ENSMUSG00000048482
AA Change: M164L

DomainStartEndE-ValueType
low complexity region 143 154 N/A INTRINSIC
NGF 175 282 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111043
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106672
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111044
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106673
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111045
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106674
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111046
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106675
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111047
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106676
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111049
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106678
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111050
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106679
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111051
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106680
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176893
AA Change: M124L

PolyPhen 2 Score 0.852 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135762
Gene: ENSMUSG00000048482
AA Change: M124L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 103 114 N/A INTRINSIC
NGF 135 242 7.57e-88 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the nerve growth factor family. It is involved in the growth, differentiation and survival of specific types of developing neurons both in the central nervous system (CNS) and the peripheral nervous system. It is also involved in regulating synaptic plasticity in the CNS. Expression of a similar gene in human is reduced in both Alzheimer's and Huntington disease patients. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygotes for targeted null alleles exhibit sensory neuron losses affecting coordination, balance, hearing, taste, and breathing, cerebellar abnormalities, increased sympathetic neuron number, and postnatal lethality. Carriers show mild defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Bdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Bdnf APN 2 109,553,892 (GRCm39) missense probably benign 0.02
IGL01285:Bdnf APN 2 109,553,931 (GRCm39) missense probably benign 0.02
IGL01595:Bdnf APN 2 109,554,273 (GRCm39) nonsense probably null
IGL01737:Bdnf APN 2 109,554,100 (GRCm39) missense probably damaging 1.00
IGL02450:Bdnf APN 2 109,553,949 (GRCm39) missense possibly damaging 0.75
IGL02793:Bdnf APN 2 109,554,196 (GRCm39) missense probably damaging 1.00
IGL02875:Bdnf APN 2 109,554,196 (GRCm39) missense probably damaging 1.00
R0505:Bdnf UTSW 2 109,505,688 (GRCm39) splice site probably null
R0626:Bdnf UTSW 2 109,553,883 (GRCm39) missense probably benign 0.01
R0792:Bdnf UTSW 2 109,554,463 (GRCm39) missense probably damaging 1.00
R1568:Bdnf UTSW 2 109,554,139 (GRCm39) missense probably damaging 1.00
R2066:Bdnf UTSW 2 109,554,247 (GRCm39) missense probably damaging 1.00
R4704:Bdnf UTSW 2 109,554,037 (GRCm39) missense possibly damaging 0.89
R5000:Bdnf UTSW 2 109,553,993 (GRCm39) missense probably benign 0.01
R5259:Bdnf UTSW 2 109,554,327 (GRCm39) missense probably benign 0.37
R5301:Bdnf UTSW 2 109,553,884 (GRCm39) missense probably benign
R6344:Bdnf UTSW 2 109,554,022 (GRCm39) missense probably benign 0.01
R7392:Bdnf UTSW 2 109,554,275 (GRCm39) missense probably benign 0.01
R9481:Bdnf UTSW 2 109,553,935 (GRCm39) missense possibly damaging 0.69
R9558:Bdnf UTSW 2 109,539,999 (GRCm39) missense
X0028:Bdnf UTSW 2 109,554,228 (GRCm39) missense possibly damaging 0.77
X0058:Bdnf UTSW 2 109,553,982 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGAGCACGTCATCGAAGAGC -3'
(R):5'- AGCCTTCCTTGGTGTAACCC -3'

Sequencing Primer
(F):5'- ACGTCATCGAAGAGCTGCTG -3'
(R):5'- ACCCATGGGATTACACTTGG -3'
Posted On 2022-10-06