Incidental Mutation 'R9702:Slc28a2b'
ID 729610
Institutional Source Beutler Lab
Gene Symbol Slc28a2b
Ensembl Gene ENSMUSG00000079071
Gene Name solute carrier family 28 member 2b
Synonyms Gm14085
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 122315422-122358521 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122354012 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 546 (I546N)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
AlphaFold A2AWR5
Predicted Effect probably damaging
Transcript: ENSMUST00000110521
AA Change: I546N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: I546N

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Slc28a2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slc28a2b APN 2 122,347,527 (GRCm39) missense probably damaging 0.98
IGL01160:Slc28a2b APN 2 122,355,277 (GRCm39) critical splice acceptor site probably null
IGL01838:Slc28a2b APN 2 122,348,464 (GRCm39) missense possibly damaging 0.65
IGL01895:Slc28a2b APN 2 122,355,572 (GRCm39) missense possibly damaging 0.75
IGL02999:Slc28a2b APN 2 122,344,995 (GRCm39) splice site probably benign
Wilted UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
K2124:Slc28a2b UTSW 2 122,355,634 (GRCm39) missense probably benign 0.00
R0084:Slc28a2b UTSW 2 122,353,314 (GRCm39) missense possibly damaging 0.95
R0092:Slc28a2b UTSW 2 122,348,078 (GRCm39) splice site probably benign
R0127:Slc28a2b UTSW 2 122,347,550 (GRCm39) critical splice donor site probably null
R0200:Slc28a2b UTSW 2 122,357,928 (GRCm39) makesense probably null
R0276:Slc28a2b UTSW 2 122,352,409 (GRCm39) missense probably damaging 1.00
R0309:Slc28a2b UTSW 2 122,348,034 (GRCm39) missense probably benign 0.04
R0403:Slc28a2b UTSW 2 122,352,335 (GRCm39) missense probably damaging 1.00
R0600:Slc28a2b UTSW 2 122,344,879 (GRCm39) missense probably damaging 0.97
R0612:Slc28a2b UTSW 2 122,352,179 (GRCm39) missense probably damaging 1.00
R1676:Slc28a2b UTSW 2 122,352,340 (GRCm39) missense probably damaging 0.99
R1801:Slc28a2b UTSW 2 122,352,133 (GRCm39) missense possibly damaging 0.57
R1986:Slc28a2b UTSW 2 122,357,910 (GRCm39) missense probably benign 0.00
R2050:Slc28a2b UTSW 2 122,353,349 (GRCm39) missense probably benign 0.21
R3078:Slc28a2b UTSW 2 122,344,895 (GRCm39) missense possibly damaging 0.63
R4075:Slc28a2b UTSW 2 122,344,892 (GRCm39) missense probably benign 0.00
R4096:Slc28a2b UTSW 2 122,353,209 (GRCm39) missense probably damaging 1.00
R4744:Slc28a2b UTSW 2 122,353,286 (GRCm39) nonsense probably null
R4796:Slc28a2b UTSW 2 122,344,940 (GRCm39) missense probably damaging 0.99
R5033:Slc28a2b UTSW 2 122,353,395 (GRCm39) critical splice donor site probably null
R5069:Slc28a2b UTSW 2 122,324,854 (GRCm39) missense possibly damaging 0.93
R5288:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5385:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5386:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5442:Slc28a2b UTSW 2 122,317,350 (GRCm39) missense probably benign
R5795:Slc28a2b UTSW 2 122,348,475 (GRCm39) missense possibly damaging 0.79
R6258:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6260:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6383:Slc28a2b UTSW 2 122,355,288 (GRCm39) missense probably benign 0.00
R7226:Slc28a2b UTSW 2 122,353,013 (GRCm39) missense probably benign 0.00
R7574:Slc28a2b UTSW 2 122,353,325 (GRCm39) missense not run
R7633:Slc28a2b UTSW 2 122,317,161 (GRCm39) missense probably null 0.05
R7705:Slc28a2b UTSW 2 122,352,110 (GRCm39) critical splice acceptor site probably null
R7726:Slc28a2b UTSW 2 122,317,214 (GRCm39) missense probably damaging 0.99
R7998:Slc28a2b UTSW 2 122,324,839 (GRCm39) missense probably damaging 0.97
R8269:Slc28a2b UTSW 2 122,352,169 (GRCm39) missense probably damaging 1.00
R8337:Slc28a2b UTSW 2 122,355,617 (GRCm39) missense probably benign 0.06
R8546:Slc28a2b UTSW 2 122,353,235 (GRCm39) missense probably benign 0.14
R8817:Slc28a2b UTSW 2 122,348,988 (GRCm39) missense possibly damaging 0.95
R8931:Slc28a2b UTSW 2 122,348,983 (GRCm39) missense
R9070:Slc28a2b UTSW 2 122,352,154 (GRCm39) missense probably damaging 1.00
R9542:Slc28a2b UTSW 2 122,324,822 (GRCm39) missense probably benign 0.26
R9782:Slc28a2b UTSW 2 122,352,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGCATTCCCTAGAACACCAAG -3'
(R):5'- ACCTGTTTGTGCCTTGGCAG -3'

Sequencing Primer
(F):5'- ACCAAGAAAGATTTGGTGTGCCTTG -3'
(R):5'- TTTGTGCCTTGGCAGAAAAGAG -3'
Posted On 2022-10-06