Incidental Mutation 'R9702:Ankrd6'
ID 729614
Institutional Source Beutler Lab
Gene Symbol Ankrd6
Ensembl Gene ENSMUSG00000040183
Gene Name ankyrin repeat domain 6
Synonyms diversin
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 32804035-32950841 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32810202 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 493 (R493H)
Ref Sequence ENSEMBL: ENSMUSP00000041300 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035719] [ENSMUST00000084748] [ENSMUST00000084749] [ENSMUST00000084750] [ENSMUST00000108166]
AlphaFold Q69ZU8
Predicted Effect possibly damaging
Transcript: ENSMUST00000035719
AA Change: R493H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041300
Gene: ENSMUSG00000040183
AA Change: R493H

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000084748
AA Change: R458H

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000081800
Gene: ENSMUSG00000040183
AA Change: R458H

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 269 2.11e2 SMART
low complexity region 330 342 N/A INTRINSIC
coiled coil region 382 410 N/A INTRINSIC
low complexity region 501 521 N/A INTRINSIC
low complexity region 590 608 N/A INTRINSIC
coiled coil region 637 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084749
AA Change: R493H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081801
Gene: ENSMUSG00000040183
AA Change: R493H

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000084750
AA Change: R493H

PolyPhen 2 Score 0.488 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000081802
Gene: ENSMUSG00000040183
AA Change: R493H

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 5.24e-4 SMART
ANK 140 169 3.74e0 SMART
ANK 173 202 6.12e-5 SMART
ANK 206 235 5.32e-5 SMART
ANK 239 268 6.24e2 SMART
low complexity region 365 377 N/A INTRINSIC
coiled coil region 417 445 N/A INTRINSIC
low complexity region 536 556 N/A INTRINSIC
low complexity region 625 643 N/A INTRINSIC
coiled coil region 672 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108166
AA Change: R434H

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103801
Gene: ENSMUSG00000040183
AA Change: R434H

DomainStartEndE-ValueType
ANK 9 38 2.55e2 SMART
ANK 41 70 2.08e-7 SMART
ANK 74 103 3.49e0 SMART
ANK 107 136 3.74e0 SMART
ANK 140 169 6.12e-5 SMART
ANK 173 202 5.32e-5 SMART
low complexity region 207 227 N/A INTRINSIC
low complexity region 306 318 N/A INTRINSIC
coiled coil region 358 386 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 561 579 N/A INTRINSIC
coiled coil region 608 648 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein which is thought to be involved in the Wnt signaling pathway and embryonic axis formation. Similar genes have been found in human, rhesus macaque, and zebrafish. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display sporadic disruption of utricle hair cell polarity but normal cochlear and vestibular hair cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Ankrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02489:Ankrd6 APN 4 32,810,298 (GRCm39) missense probably damaging 1.00
IGL03247:Ankrd6 APN 4 32,860,441 (GRCm39) start codon destroyed possibly damaging 0.76
IGL03382:Ankrd6 APN 4 32,808,771 (GRCm39) missense probably damaging 1.00
R0360:Ankrd6 UTSW 4 32,836,424 (GRCm39) missense probably damaging 1.00
R0711:Ankrd6 UTSW 4 32,815,326 (GRCm39) missense probably damaging 1.00
R1074:Ankrd6 UTSW 4 32,822,232 (GRCm39) missense probably damaging 1.00
R1075:Ankrd6 UTSW 4 32,822,232 (GRCm39) missense probably damaging 1.00
R1498:Ankrd6 UTSW 4 32,810,289 (GRCm39) missense probably benign 0.17
R1719:Ankrd6 UTSW 4 32,828,774 (GRCm39) missense probably damaging 1.00
R1823:Ankrd6 UTSW 4 32,824,427 (GRCm39) missense probably damaging 1.00
R2889:Ankrd6 UTSW 4 32,818,704 (GRCm39) missense probably damaging 0.99
R2897:Ankrd6 UTSW 4 32,860,438 (GRCm39) missense probably damaging 0.98
R3815:Ankrd6 UTSW 4 32,806,206 (GRCm39) missense probably benign 0.39
R3836:Ankrd6 UTSW 4 32,817,531 (GRCm39) missense probably damaging 1.00
R4127:Ankrd6 UTSW 4 32,822,241 (GRCm39) missense probably damaging 1.00
R4994:Ankrd6 UTSW 4 32,860,387 (GRCm39) missense probably damaging 0.99
R5250:Ankrd6 UTSW 4 32,860,335 (GRCm39) missense probably damaging 1.00
R5291:Ankrd6 UTSW 4 32,823,446 (GRCm39) missense probably damaging 1.00
R5335:Ankrd6 UTSW 4 32,818,651 (GRCm39) missense probably damaging 1.00
R5948:Ankrd6 UTSW 4 32,817,075 (GRCm39) missense possibly damaging 0.91
R6336:Ankrd6 UTSW 4 32,860,411 (GRCm39) missense probably damaging 1.00
R6345:Ankrd6 UTSW 4 32,810,266 (GRCm39) missense probably damaging 1.00
R6349:Ankrd6 UTSW 4 32,822,231 (GRCm39) missense probably damaging 1.00
R6516:Ankrd6 UTSW 4 32,836,427 (GRCm39) missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32,806,420 (GRCm39) missense probably damaging 1.00
R6902:Ankrd6 UTSW 4 32,806,419 (GRCm39) missense probably damaging 1.00
R6999:Ankrd6 UTSW 4 32,823,459 (GRCm39) missense probably benign
R7044:Ankrd6 UTSW 4 32,815,260 (GRCm39) missense possibly damaging 0.93
R7307:Ankrd6 UTSW 4 32,816,949 (GRCm39) missense possibly damaging 0.92
R7394:Ankrd6 UTSW 4 32,821,298 (GRCm39) missense probably damaging 0.99
R7496:Ankrd6 UTSW 4 32,810,299 (GRCm39) missense probably damaging 0.99
R7662:Ankrd6 UTSW 4 32,818,694 (GRCm39) missense probably damaging 1.00
R7873:Ankrd6 UTSW 4 32,806,499 (GRCm39) missense possibly damaging 0.91
R8328:Ankrd6 UTSW 4 32,810,215 (GRCm39) missense probably benign 0.27
R8739:Ankrd6 UTSW 4 32,806,337 (GRCm39) missense possibly damaging 0.47
R8937:Ankrd6 UTSW 4 32,823,452 (GRCm39) missense possibly damaging 0.95
R9211:Ankrd6 UTSW 4 32,806,580 (GRCm39) missense probably damaging 1.00
R9295:Ankrd6 UTSW 4 32,822,160 (GRCm39) missense probably damaging 0.98
R9319:Ankrd6 UTSW 4 32,806,324 (GRCm39) missense probably benign 0.02
R9741:Ankrd6 UTSW 4 32,860,339 (GRCm39) nonsense probably null
X0064:Ankrd6 UTSW 4 32,806,435 (GRCm39) missense possibly damaging 0.93
Z1176:Ankrd6 UTSW 4 32,824,486 (GRCm39) missense probably damaging 0.98
Z1176:Ankrd6 UTSW 4 32,806,326 (GRCm39) missense probably benign 0.08
Z1176:Ankrd6 UTSW 4 32,806,229 (GRCm39) missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGGACTACACATTCTTCGCTC -3'
(R):5'- CGTGCTGTGAAATAGGGCAG -3'

Sequencing Primer
(F):5'- AGGACTACACATTCTTCGCTCCTAAC -3'
(R):5'- TTTGCAGACTCCGCTCATGGG -3'
Posted On 2022-10-06