Incidental Mutation 'R9702:Vwa1'
ID 729615
Institutional Source Beutler Lab
Gene Symbol Vwa1
Ensembl Gene ENSMUSG00000042116
Gene Name von Willebrand factor A domain containing 1
Synonyms 4932416A11Rik, WARP
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 155852952-155859042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 155857336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 154 (P154L)
Ref Sequence ENSEMBL: ENSMUSP00000040405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042196]
AlphaFold Q8R2Z5
Predicted Effect probably damaging
Transcript: ENSMUST00000042196
AA Change: P154L

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000040405
Gene: ENSMUSG00000042116
AA Change: P154L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
VWA 32 210 3.05e-36 SMART
FN3 212 292 1.95e0 SMART
FN3 305 385 1.4e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VWA1 belongs to the von Willebrand factor (VWF; MIM 613160) A (VWFA) domain superfamily of extracellular matrix proteins and appears to play a role in cartilage structure and function (Fitzgerald et al., 2002 [PubMed 12062410]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal motor coordination/balance, increased thermal nociceptive threshold, and altered peripheral nerve structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Vwa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Vwa1 APN 4 155,855,200 (GRCm39) critical splice donor site probably null
IGL01611:Vwa1 APN 4 155,855,255 (GRCm39) missense possibly damaging 0.64
R1174:Vwa1 UTSW 4 155,857,723 (GRCm39) missense probably damaging 0.96
R1433:Vwa1 UTSW 4 155,857,358 (GRCm39) missense probably damaging 0.99
R1953:Vwa1 UTSW 4 155,857,571 (GRCm39) missense probably damaging 1.00
R2006:Vwa1 UTSW 4 155,855,307 (GRCm39) missense probably benign
R2105:Vwa1 UTSW 4 155,857,250 (GRCm39) missense probably damaging 1.00
R2346:Vwa1 UTSW 4 155,857,526 (GRCm39) missense probably benign 0.00
R3891:Vwa1 UTSW 4 155,857,651 (GRCm39) missense probably damaging 1.00
R4919:Vwa1 UTSW 4 155,855,057 (GRCm39) missense probably benign 0.10
R5285:Vwa1 UTSW 4 155,855,352 (GRCm39) missense probably benign 0.38
R5320:Vwa1 UTSW 4 155,855,369 (GRCm39) missense probably benign 0.00
R5554:Vwa1 UTSW 4 155,857,695 (GRCm39) missense probably damaging 1.00
R5666:Vwa1 UTSW 4 155,858,922 (GRCm39) missense probably damaging 1.00
R5670:Vwa1 UTSW 4 155,858,922 (GRCm39) missense probably damaging 1.00
R6433:Vwa1 UTSW 4 155,857,226 (GRCm39) missense probably benign 0.07
R8135:Vwa1 UTSW 4 155,857,351 (GRCm39) missense probably damaging 1.00
R8400:Vwa1 UTSW 4 155,857,225 (GRCm39) missense probably benign 0.03
R8784:Vwa1 UTSW 4 155,857,345 (GRCm39) missense probably damaging 1.00
R8965:Vwa1 UTSW 4 155,857,440 (GRCm39) nonsense probably null
R9062:Vwa1 UTSW 4 155,854,820 (GRCm39) missense probably benign
R9306:Vwa1 UTSW 4 155,855,328 (GRCm39) missense probably benign 0.15
R9518:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9519:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9597:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9634:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9697:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9699:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9703:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9755:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9800:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
R9801:Vwa1 UTSW 4 155,857,336 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GATTCACAGGACCTGCCTCTTC -3'
(R):5'- TTTGACCAGTACAGTTCAGGCC -3'

Sequencing Primer
(F):5'- GCCTCTTCCCACCTACCAGTTATG -3'
(R):5'- GTACAGTTCAGGCCAGGCTATAC -3'
Posted On 2022-10-06