Incidental Mutation 'R9702:Vmn1r158'
ID 729619
Institutional Source Beutler Lab
Gene Symbol Vmn1r158
Ensembl Gene ENSMUSG00000094700
Gene Name vomeronasal 1 receptor 158
Synonyms Gm16455
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.653) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 22489284-22490207 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22490065 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 48 (Q48L)
Ref Sequence ENSEMBL: ENSMUSP00000133990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174643]
AlphaFold G3UY92
Predicted Effect probably benign
Transcript: ENSMUST00000174643
AA Change: Q48L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133990
Gene: ENSMUSG00000094700
AA Change: Q48L

DomainStartEndE-ValueType
Pfam:TAS2R 8 298 2.9e-15 PFAM
Pfam:7tm_1 39 290 5.5e-9 PFAM
Pfam:V1R 41 298 3.2e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Vmn1r158
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01147:Vmn1r158 APN 7 22,490,204 (GRCm39) missense probably benign 0.01
R1173:Vmn1r158 UTSW 7 22,489,870 (GRCm39) missense probably benign 0.19
R1574:Vmn1r158 UTSW 7 22,489,772 (GRCm39) missense probably damaging 1.00
R1574:Vmn1r158 UTSW 7 22,489,772 (GRCm39) missense probably damaging 1.00
R1725:Vmn1r158 UTSW 7 22,490,072 (GRCm39) missense probably benign 0.08
R1777:Vmn1r158 UTSW 7 22,489,855 (GRCm39) missense probably damaging 1.00
R1813:Vmn1r158 UTSW 7 22,490,143 (GRCm39) missense probably damaging 1.00
R1896:Vmn1r158 UTSW 7 22,490,143 (GRCm39) missense probably damaging 1.00
R2077:Vmn1r158 UTSW 7 22,489,815 (GRCm39) missense probably benign 0.03
R3749:Vmn1r158 UTSW 7 22,489,639 (GRCm39) missense probably damaging 1.00
R4872:Vmn1r158 UTSW 7 22,490,179 (GRCm39) missense possibly damaging 0.94
R5238:Vmn1r158 UTSW 7 22,489,799 (GRCm39) missense probably benign
R6500:Vmn1r158 UTSW 7 22,490,078 (GRCm39) missense possibly damaging 0.89
R6511:Vmn1r158 UTSW 7 22,490,116 (GRCm39) missense probably benign 0.00
R6581:Vmn1r158 UTSW 7 22,489,465 (GRCm39) missense possibly damaging 0.69
R6751:Vmn1r158 UTSW 7 22,489,306 (GRCm39) missense probably damaging 0.96
R7168:Vmn1r158 UTSW 7 22,490,101 (GRCm39) missense possibly damaging 0.82
R7337:Vmn1r158 UTSW 7 22,489,649 (GRCm39) missense probably benign 0.00
R7747:Vmn1r158 UTSW 7 22,489,725 (GRCm39) missense probably benign 0.15
R7902:Vmn1r158 UTSW 7 22,489,433 (GRCm39) missense possibly damaging 0.67
R8328:Vmn1r158 UTSW 7 22,489,487 (GRCm39) missense probably damaging 1.00
R8400:Vmn1r158 UTSW 7 22,489,305 (GRCm39) nonsense probably null
R8809:Vmn1r158 UTSW 7 22,489,775 (GRCm39) missense probably damaging 0.97
R9227:Vmn1r158 UTSW 7 22,489,469 (GRCm39) missense probably benign 0.02
R9468:Vmn1r158 UTSW 7 22,489,888 (GRCm39) missense probably damaging 1.00
R9719:Vmn1r158 UTSW 7 22,489,331 (GRCm39) missense possibly damaging 0.95
Z1177:Vmn1r158 UTSW 7 22,489,883 (GRCm39) missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- ACTGATGGAAACTCAGGACAC -3'
(R):5'- CCCACAGAGAGTAGTGTCCTATC -3'

Sequencing Primer
(F):5'- CTCAGGACACAGGTGGAAC -3'
(R):5'- CACAGAGAGTAGTGTCCTATCTATTC -3'
Posted On 2022-10-06