Incidental Mutation 'R9702:Inpp5f'
ID 729623
Institutional Source Beutler Lab
Gene Symbol Inpp5f
Ensembl Gene ENSMUSG00000042105
Gene Name inositol polyphosphate-5-phosphatase F
Synonyms cI-27, 5830435P03Rik, SAC2
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.230) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 128213052-128298149 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128278515 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 435 (D435A)
Ref Sequence ENSEMBL: ENSMUSP00000045910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043138]
AlphaFold Q8CDA1
Predicted Effect possibly damaging
Transcript: ENSMUST00000043138
AA Change: D435A

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045910
Gene: ENSMUSG00000042105
AA Change: D435A

DomainStartEndE-ValueType
Pfam:Syja_N 49 416 1.2e-85 PFAM
Blast:IPPc 449 568 6e-13 BLAST
Pfam:hSac2 590 698 9.1e-25 PFAM
low complexity region 1042 1054 N/A INTRINSIC
low complexity region 1059 1065 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an inositol 1,4,5-trisphosphate (InsP3) 5-phosphatase and contains a Sac domain. The activity of this protein is specific for phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol 3,4,5-trisphosphate. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit increased isoproterenol-induced cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Inpp5f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Inpp5f APN 7 128,265,991 (GRCm39) missense probably benign 0.04
IGL01316:Inpp5f APN 7 128,292,430 (GRCm39) splice site probably benign
IGL01455:Inpp5f APN 7 128,279,773 (GRCm39) missense probably damaging 1.00
IGL01471:Inpp5f APN 7 128,277,122 (GRCm39) missense probably damaging 0.99
IGL01590:Inpp5f APN 7 128,266,031 (GRCm39) critical splice donor site probably null
IGL01942:Inpp5f APN 7 128,269,493 (GRCm39) missense probably damaging 1.00
IGL02092:Inpp5f APN 7 128,286,948 (GRCm39) missense probably damaging 1.00
IGL02137:Inpp5f APN 7 128,296,853 (GRCm39) missense probably damaging 1.00
IGL02664:Inpp5f APN 7 128,265,738 (GRCm39) missense probably damaging 1.00
IGL02812:Inpp5f APN 7 128,284,030 (GRCm39) missense probably damaging 1.00
IGL02942:Inpp5f APN 7 128,296,624 (GRCm39) missense probably benign 0.29
PIT4480001:Inpp5f UTSW 7 128,286,858 (GRCm39) missense probably benign 0.32
PIT4812001:Inpp5f UTSW 7 128,294,032 (GRCm39) missense probably benign 0.39
R0243:Inpp5f UTSW 7 128,296,907 (GRCm39) missense probably damaging 1.00
R0346:Inpp5f UTSW 7 128,292,392 (GRCm39) missense probably damaging 1.00
R1186:Inpp5f UTSW 7 128,296,307 (GRCm39) missense probably benign
R1375:Inpp5f UTSW 7 128,265,753 (GRCm39) nonsense probably null
R1918:Inpp5f UTSW 7 128,265,693 (GRCm39) splice site probably benign
R2307:Inpp5f UTSW 7 128,296,034 (GRCm39) missense probably damaging 1.00
R3716:Inpp5f UTSW 7 128,292,394 (GRCm39) missense probably damaging 1.00
R4157:Inpp5f UTSW 7 128,281,423 (GRCm39) intron probably benign
R4647:Inpp5f UTSW 7 128,260,833 (GRCm39) missense possibly damaging 0.94
R4705:Inpp5f UTSW 7 128,265,711 (GRCm39) missense probably damaging 0.97
R4713:Inpp5f UTSW 7 128,265,449 (GRCm39) missense probably damaging 0.99
R4818:Inpp5f UTSW 7 128,286,853 (GRCm39) missense probably damaging 1.00
R4914:Inpp5f UTSW 7 128,286,840 (GRCm39) missense probably damaging 1.00
R4915:Inpp5f UTSW 7 128,286,840 (GRCm39) missense probably damaging 1.00
R4917:Inpp5f UTSW 7 128,286,840 (GRCm39) missense probably damaging 1.00
R5069:Inpp5f UTSW 7 128,278,451 (GRCm39) critical splice acceptor site probably null
R5181:Inpp5f UTSW 7 128,281,555 (GRCm39) missense probably damaging 1.00
R5234:Inpp5f UTSW 7 128,265,407 (GRCm39) missense probably benign
R6299:Inpp5f UTSW 7 128,237,884 (GRCm39) missense possibly damaging 0.87
R6389:Inpp5f UTSW 7 128,279,780 (GRCm39) missense probably damaging 1.00
R6530:Inpp5f UTSW 7 128,265,802 (GRCm39) nonsense probably null
R6545:Inpp5f UTSW 7 128,296,280 (GRCm39) missense possibly damaging 0.88
R7259:Inpp5f UTSW 7 128,271,681 (GRCm39) missense probably benign 0.00
R7383:Inpp5f UTSW 7 128,296,310 (GRCm39) missense probably damaging 1.00
R7427:Inpp5f UTSW 7 128,281,529 (GRCm39) missense probably damaging 1.00
R7428:Inpp5f UTSW 7 128,281,529 (GRCm39) missense probably damaging 1.00
R7679:Inpp5f UTSW 7 128,296,247 (GRCm39) missense possibly damaging 0.68
R7809:Inpp5f UTSW 7 128,269,367 (GRCm39) missense probably damaging 1.00
R7840:Inpp5f UTSW 7 128,296,526 (GRCm39) missense probably benign
R7912:Inpp5f UTSW 7 128,294,037 (GRCm39) missense probably benign
R7915:Inpp5f UTSW 7 128,269,433 (GRCm39) missense probably benign 0.25
R7960:Inpp5f UTSW 7 128,295,638 (GRCm39) splice site probably null
R8027:Inpp5f UTSW 7 128,292,397 (GRCm39) missense probably damaging 1.00
R8154:Inpp5f UTSW 7 128,265,991 (GRCm39) missense possibly damaging 0.73
R8213:Inpp5f UTSW 7 128,281,529 (GRCm39) missense probably damaging 1.00
R9499:Inpp5f UTSW 7 128,295,437 (GRCm39) missense possibly damaging 0.62
R9519:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9544:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9597:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9598:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9634:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9701:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9784:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9802:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
R9803:Inpp5f UTSW 7 128,278,515 (GRCm39) missense possibly damaging 0.62
RF001:Inpp5f UTSW 7 128,296,807 (GRCm39) missense probably damaging 1.00
X0061:Inpp5f UTSW 7 128,284,021 (GRCm39) missense probably damaging 1.00
Z1088:Inpp5f UTSW 7 128,296,673 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GCCTGGACACACAGAGACT -3'
(R):5'- ACATGATTTCACAGACCAAAAGTC -3'

Sequencing Primer
(F):5'- TGCTGGCATTAAAACCTGAGC -3'
(R):5'- GTGCTTATGAGTCAGACGAACACTC -3'
Posted On 2022-10-06