Incidental Mutation 'R9702:Fbxo30'
ID 729624
Institutional Source Beutler Lab
Gene Symbol Fbxo30
Ensembl Gene ENSMUSG00000047648
Gene Name F-box protein 30
Synonyms 1700026A16Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.214) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 11157074-11173796 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 11166382 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 368 (C368F)
Ref Sequence ENSEMBL: ENSMUSP00000068230 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070300] [ENSMUST00000129456]
AlphaFold Q8BJL1
Predicted Effect probably benign
Transcript: ENSMUST00000070300
AA Change: C368F

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068230
Gene: ENSMUSG00000047648
AA Change: C368F

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 8 100 2.5e-42 PFAM
Pfam:F-box_4 610 725 1.6e-52 PFAM
Pfam:F-box 612 653 3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129456
AA Change: C368F

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000117687
Gene: ENSMUSG00000047648
AA Change: C368F

DomainStartEndE-ValueType
PDB:2YRE|A 1 88 6e-51 PDB
SCOP:d1k2fa_ 58 93 7e-3 SMART
Pfam:F-box 612 653 2.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class and it is upregulated in nasopharyngeal carcinoma. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Fbxo30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Fbxo30 APN 10 11,166,283 (GRCm39) missense probably benign 0.01
IGL00971:Fbxo30 APN 10 11,166,042 (GRCm39) missense probably benign
IGL02388:Fbxo30 APN 10 11,166,122 (GRCm39) missense probably benign 0.01
PIT4468001:Fbxo30 UTSW 10 11,166,700 (GRCm39) missense possibly damaging 0.95
R0014:Fbxo30 UTSW 10 11,165,603 (GRCm39) nonsense probably null
R0144:Fbxo30 UTSW 10 11,170,964 (GRCm39) missense probably damaging 1.00
R0709:Fbxo30 UTSW 10 11,167,057 (GRCm39) missense possibly damaging 0.79
R1583:Fbxo30 UTSW 10 11,167,118 (GRCm39) missense possibly damaging 0.67
R1791:Fbxo30 UTSW 10 11,165,531 (GRCm39) nonsense probably null
R2018:Fbxo30 UTSW 10 11,166,772 (GRCm39) missense probably damaging 0.98
R2317:Fbxo30 UTSW 10 11,166,078 (GRCm39) missense probably damaging 0.98
R3842:Fbxo30 UTSW 10 11,165,856 (GRCm39) missense probably damaging 0.98
R4579:Fbxo30 UTSW 10 11,165,293 (GRCm39) missense probably benign 0.00
R4655:Fbxo30 UTSW 10 11,166,837 (GRCm39) missense probably damaging 1.00
R4751:Fbxo30 UTSW 10 11,165,939 (GRCm39) missense probably benign 0.01
R4998:Fbxo30 UTSW 10 11,166,507 (GRCm39) missense probably damaging 0.98
R5325:Fbxo30 UTSW 10 11,166,846 (GRCm39) missense possibly damaging 0.89
R5463:Fbxo30 UTSW 10 11,166,813 (GRCm39) missense probably damaging 1.00
R5534:Fbxo30 UTSW 10 11,165,409 (GRCm39) missense possibly damaging 0.91
R5594:Fbxo30 UTSW 10 11,166,223 (GRCm39) missense probably benign 0.13
R5757:Fbxo30 UTSW 10 11,166,165 (GRCm39) missense probably benign 0.08
R5917:Fbxo30 UTSW 10 11,165,262 (GRCm39) critical splice acceptor site probably null
R6232:Fbxo30 UTSW 10 11,165,602 (GRCm39) missense possibly damaging 0.90
R6472:Fbxo30 UTSW 10 11,166,975 (GRCm39) missense probably damaging 1.00
R6677:Fbxo30 UTSW 10 11,166,380 (GRCm39) missense possibly damaging 0.61
R6802:Fbxo30 UTSW 10 11,167,224 (GRCm39) missense probably damaging 1.00
R7128:Fbxo30 UTSW 10 11,165,860 (GRCm39) nonsense probably null
R8353:Fbxo30 UTSW 10 11,166,479 (GRCm39) missense probably benign 0.30
R8453:Fbxo30 UTSW 10 11,166,479 (GRCm39) missense probably benign 0.30
R8796:Fbxo30 UTSW 10 11,165,320 (GRCm39) missense probably damaging 1.00
R9215:Fbxo30 UTSW 10 11,167,243 (GRCm39) missense probably damaging 1.00
X0012:Fbxo30 UTSW 10 11,166,210 (GRCm39) missense probably benign 0.00
X0066:Fbxo30 UTSW 10 11,166,556 (GRCm39) missense probably damaging 1.00
Z1176:Fbxo30 UTSW 10 11,171,064 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATGTGTATTCAGGTCAAAGGCC -3'
(R):5'- ATCAGATCTATTCCTTGGAGGCC -3'

Sequencing Primer
(F):5'- GGCCAGGATCAAAATTTTCATGGTG -3'
(R):5'- GCCCATGGGATCTTCTGCAAC -3'
Posted On 2022-10-06