Incidental Mutation 'R9702:Sobp'
ID 729626
Institutional Source Beutler Lab
Gene Symbol Sobp
Ensembl Gene ENSMUSG00000038248
Gene Name sine oculis binding protein
Synonyms 5330439J01Rik, 2900009C16Rik, jc, Jxc1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.682) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 42878496-43050526 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 42897944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 547 (N547S)
Ref Sequence ENSEMBL: ENSMUSP00000040072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040275]
AlphaFold Q0P5V2
Predicted Effect probably benign
Transcript: ENSMUST00000040275
AA Change: N547S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000040072
Gene: ENSMUSG00000038248
AA Change: N547S

DomainStartEndE-ValueType
low complexity region 125 139 N/A INTRINSIC
internal_repeat_1 149 201 2.34e-5 PROSPERO
Pfam:SOBP 224 543 1.5e-88 PFAM
low complexity region 565 583 N/A INTRINSIC
low complexity region 590 603 N/A INTRINSIC
low complexity region 625 639 N/A INTRINSIC
low complexity region 695 714 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear zinc finger protein that is involved in development of the cochlea. Defects in this gene have also been linked to intellectual disability. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit open-field hyperactivity and circling behavior from weaning. Their hearing thresholds are elevated at all frequencies; the hearing impairment does not progress over time. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Sobp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Sobp APN 10 42,898,874 (GRCm39) missense probably damaging 1.00
IGL02112:Sobp APN 10 42,897,873 (GRCm39) missense probably benign 0.07
R0071:Sobp UTSW 10 43,033,993 (GRCm39) missense probably damaging 1.00
R0071:Sobp UTSW 10 43,033,993 (GRCm39) missense probably damaging 1.00
R0602:Sobp UTSW 10 42,898,385 (GRCm39) missense probably damaging 1.00
R0792:Sobp UTSW 10 42,898,689 (GRCm39) missense probably damaging 0.99
R0847:Sobp UTSW 10 42,898,415 (GRCm39) missense probably damaging 1.00
R0948:Sobp UTSW 10 42,898,205 (GRCm39) missense probably damaging 1.00
R1298:Sobp UTSW 10 42,898,331 (GRCm39) missense probably damaging 1.00
R1484:Sobp UTSW 10 43,036,827 (GRCm39) missense probably damaging 1.00
R1486:Sobp UTSW 10 42,898,518 (GRCm39) missense probably benign 0.42
R1543:Sobp UTSW 10 42,897,720 (GRCm39) missense probably damaging 0.97
R1571:Sobp UTSW 10 43,033,942 (GRCm39) missense possibly damaging 0.93
R1807:Sobp UTSW 10 43,036,822 (GRCm39) missense possibly damaging 0.79
R2198:Sobp UTSW 10 42,898,520 (GRCm39) missense possibly damaging 0.81
R2316:Sobp UTSW 10 43,034,034 (GRCm39) missense possibly damaging 0.75
R4165:Sobp UTSW 10 42,897,644 (GRCm39) missense probably damaging 1.00
R4235:Sobp UTSW 10 42,898,896 (GRCm39) missense probably damaging 1.00
R4378:Sobp UTSW 10 42,897,300 (GRCm39) missense probably damaging 0.97
R4587:Sobp UTSW 10 43,034,020 (GRCm39) missense probably damaging 1.00
R5108:Sobp UTSW 10 43,036,815 (GRCm39) missense probably damaging 1.00
R6165:Sobp UTSW 10 42,898,599 (GRCm39) missense probably damaging 1.00
R7069:Sobp UTSW 10 42,897,436 (GRCm39) missense probably benign 0.37
R7346:Sobp UTSW 10 42,898,831 (GRCm39) missense probably damaging 1.00
R7419:Sobp UTSW 10 42,897,804 (GRCm39) missense probably benign 0.00
R7423:Sobp UTSW 10 42,898,564 (GRCm39) nonsense probably null
R7475:Sobp UTSW 10 42,897,830 (GRCm39) missense probably damaging 0.98
R7994:Sobp UTSW 10 42,897,163 (GRCm39) nonsense probably null
R8472:Sobp UTSW 10 42,898,392 (GRCm39) missense probably damaging 0.99
R8558:Sobp UTSW 10 43,003,888 (GRCm39) missense probably damaging 1.00
R8770:Sobp UTSW 10 43,036,788 (GRCm39) missense probably damaging 1.00
R8832:Sobp UTSW 10 43,036,824 (GRCm39) missense probably damaging 1.00
R8979:Sobp UTSW 10 42,896,976 (GRCm39) critical splice donor site probably null
R9109:Sobp UTSW 10 42,898,902 (GRCm39) missense probably damaging 1.00
R9213:Sobp UTSW 10 42,898,374 (GRCm39) missense probably benign 0.01
R9298:Sobp UTSW 10 42,898,902 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCACGTTGTGCAGCCG -3'
(R):5'- CTTCCCTCCGGTTAGCATGATG -3'

Sequencing Primer
(F):5'- TCAGGTCGATGACGCCGTC -3'
(R):5'- TCCGGTTAGCATGATGCCAAAC -3'
Posted On 2022-10-06