Incidental Mutation 'R9702:Esyt1'
ID 729628
Institutional Source Beutler Lab
Gene Symbol Esyt1
Ensembl Gene ENSMUSG00000025366
Gene Name extended synaptotagmin-like protein 1
Synonyms Mbc2, Fam62a, vp115
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.158) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 128346117-128361728 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 128356607 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 346 (S346L)
Ref Sequence ENSEMBL: ENSMUSP00000026427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026427]
AlphaFold Q3U7R1
Predicted Effect probably damaging
Transcript: ENSMUST00000026427
AA Change: S346L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026427
Gene: ENSMUSG00000025366
AA Change: S346L

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:SMP_LBD 125 303 4.3e-80 PFAM
C2 320 422 1.27e-17 SMART
C2 469 563 4.62e-11 SMART
C2 635 737 4.05e-25 SMART
C2 786 879 3.05e-11 SMART
low complexity region 909 921 N/A INTRINSIC
C2 975 1080 1.51e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220429
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Esyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Esyt1 APN 10 128,353,504 (GRCm39) missense possibly damaging 0.94
IGL00518:Esyt1 APN 10 128,357,743 (GRCm39) missense probably benign 0.00
IGL00534:Esyt1 APN 10 128,351,553 (GRCm39) critical splice donor site probably null
IGL00578:Esyt1 APN 10 128,347,612 (GRCm39) missense probably damaging 1.00
IGL00899:Esyt1 APN 10 128,352,932 (GRCm39) missense probably damaging 1.00
IGL01308:Esyt1 APN 10 128,355,660 (GRCm39) missense possibly damaging 0.62
IGL01373:Esyt1 APN 10 128,354,810 (GRCm39) missense possibly damaging 0.91
IGL01476:Esyt1 APN 10 128,347,363 (GRCm39) missense probably damaging 0.99
IGL01655:Esyt1 APN 10 128,358,181 (GRCm39) missense possibly damaging 0.72
IGL02302:Esyt1 APN 10 128,348,236 (GRCm39) missense probably damaging 1.00
IGL02441:Esyt1 APN 10 128,348,293 (GRCm39) missense possibly damaging 0.89
IGL02550:Esyt1 APN 10 128,357,962 (GRCm39) missense probably damaging 1.00
IGL02653:Esyt1 APN 10 128,346,877 (GRCm39) missense probably benign
IGL02948:Esyt1 APN 10 128,355,040 (GRCm39) missense probably damaging 0.96
IGL02986:Esyt1 APN 10 128,352,626 (GRCm39) missense probably damaging 0.96
IGL03033:Esyt1 APN 10 128,352,252 (GRCm39) missense probably benign 0.00
R0039:Esyt1 UTSW 10 128,356,831 (GRCm39) missense probably damaging 0.99
R0285:Esyt1 UTSW 10 128,348,087 (GRCm39) missense possibly damaging 0.50
R0453:Esyt1 UTSW 10 128,348,078 (GRCm39) missense probably benign 0.00
R1123:Esyt1 UTSW 10 128,352,427 (GRCm39) missense probably benign 0.35
R1496:Esyt1 UTSW 10 128,348,297 (GRCm39) missense possibly damaging 0.63
R1569:Esyt1 UTSW 10 128,354,863 (GRCm39) missense possibly damaging 0.88
R1691:Esyt1 UTSW 10 128,361,403 (GRCm39) missense probably benign 0.01
R1813:Esyt1 UTSW 10 128,355,487 (GRCm39) missense probably benign
R1827:Esyt1 UTSW 10 128,352,238 (GRCm39) missense probably benign 0.01
R2038:Esyt1 UTSW 10 128,347,820 (GRCm39) missense probably benign 0.00
R2039:Esyt1 UTSW 10 128,347,820 (GRCm39) missense probably benign 0.00
R2115:Esyt1 UTSW 10 128,357,973 (GRCm39) missense probably damaging 0.99
R2696:Esyt1 UTSW 10 128,352,914 (GRCm39) missense probably damaging 1.00
R3919:Esyt1 UTSW 10 128,356,905 (GRCm39) unclassified probably benign
R3980:Esyt1 UTSW 10 128,347,393 (GRCm39) missense probably damaging 0.99
R4223:Esyt1 UTSW 10 128,356,517 (GRCm39) missense probably damaging 1.00
R4225:Esyt1 UTSW 10 128,356,517 (GRCm39) missense probably damaging 1.00
R5249:Esyt1 UTSW 10 128,352,443 (GRCm39) missense probably benign 0.00
R5534:Esyt1 UTSW 10 128,355,329 (GRCm39) missense probably benign 0.07
R5704:Esyt1 UTSW 10 128,347,379 (GRCm39) missense probably damaging 1.00
R6252:Esyt1 UTSW 10 128,347,771 (GRCm39) missense probably benign 0.01
R6431:Esyt1 UTSW 10 128,352,543 (GRCm39) critical splice donor site probably null
R7013:Esyt1 UTSW 10 128,361,520 (GRCm39) missense probably damaging 1.00
R7102:Esyt1 UTSW 10 128,352,105 (GRCm39) missense probably damaging 0.98
R7152:Esyt1 UTSW 10 128,351,629 (GRCm39) missense possibly damaging 0.79
R7570:Esyt1 UTSW 10 128,354,801 (GRCm39) missense possibly damaging 0.52
R7700:Esyt1 UTSW 10 128,351,723 (GRCm39) splice site probably benign
R7732:Esyt1 UTSW 10 128,357,694 (GRCm39) critical splice donor site probably null
R8009:Esyt1 UTSW 10 128,347,354 (GRCm39) missense probably benign 0.01
R8049:Esyt1 UTSW 10 128,347,955 (GRCm39) missense probably benign
R8222:Esyt1 UTSW 10 128,347,647 (GRCm39) missense possibly damaging 0.77
R8365:Esyt1 UTSW 10 128,352,422 (GRCm39) missense possibly damaging 0.89
R8366:Esyt1 UTSW 10 128,352,422 (GRCm39) missense possibly damaging 0.89
R8407:Esyt1 UTSW 10 128,347,796 (GRCm39) missense probably damaging 1.00
R8962:Esyt1 UTSW 10 128,356,566 (GRCm39) missense possibly damaging 0.50
R9209:Esyt1 UTSW 10 128,361,356 (GRCm39) missense probably benign 0.00
R9305:Esyt1 UTSW 10 128,355,388 (GRCm39) missense possibly damaging 0.82
R9703:Esyt1 UTSW 10 128,354,796 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGCCTCATGTTGTGTGCATATAC -3'
(R):5'- GTATGGCACCTCTCAGAAGAC -3'

Sequencing Primer
(F):5'- ACACACACATTCCTCGGCTTC -3'
(R):5'- AAGACTGAGCTTTCTCTCAAGGGC -3'
Posted On 2022-10-06