Incidental Mutation 'R9702:Mrps23'
ID 729630
Institutional Source Beutler Lab
Gene Symbol Mrps23
Ensembl Gene ENSMUSG00000023723
Gene Name mitochondrial ribosomal protein S23
Synonyms Rpms23, D11Bwg1153e, 2310047I09Rik
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 88095214-88102333 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 88100998 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 121 (T121M)
Ref Sequence ENSEMBL: ENSMUSP00000024486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024486] [ENSMUST00000107915] [ENSMUST00000118784] [ENSMUST00000139170]
AlphaFold Q8VE22
Predicted Effect probably damaging
Transcript: ENSMUST00000024486
AA Change: T121M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000024486
Gene: ENSMUSG00000023723
AA Change: T121M

DomainStartEndE-ValueType
Pfam:MRP-S23 2 130 2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107915
SMART Domains Protein: ENSMUSP00000103548
Gene: ENSMUSG00000023723

DomainStartEndE-ValueType
Pfam:MRP-S23 2 99 1.1e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118784
AA Change: T102M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113512
Gene: ENSMUSG00000023723
AA Change: T102M

DomainStartEndE-ValueType
Pfam:MRP-S23 1 114 1.7e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139170
AA Change: T102M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117416
Gene: ENSMUSG00000023723
AA Change: T102M

DomainStartEndE-ValueType
Pfam:MRP-S23 1 114 4.8e-39 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122963
Gene: ENSMUSG00000023723
AA Change: T63M

DomainStartEndE-ValueType
Pfam:MRP-S23 15 73 8.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. A pseudogene corresponding to this gene is found on chromosome 7p. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Mrps23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03081:Mrps23 APN 11 88,101,043 (GRCm39) missense probably benign 0.02
IGL03247:Mrps23 APN 11 88,100,922 (GRCm39) splice site probably benign
R0183:Mrps23 UTSW 11 88,100,980 (GRCm39) missense probably damaging 1.00
R0347:Mrps23 UTSW 11 88,101,519 (GRCm39) missense probably benign
R0492:Mrps23 UTSW 11 88,101,511 (GRCm39) missense probably benign 0.02
R2698:Mrps23 UTSW 11 88,096,193 (GRCm39) intron probably benign
R2917:Mrps23 UTSW 11 88,100,743 (GRCm39) missense probably damaging 1.00
R3434:Mrps23 UTSW 11 88,100,940 (GRCm39) missense probably damaging 1.00
R7393:Mrps23 UTSW 11 88,095,284 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCATTTCCCAGGCCCAAG -3'
(R):5'- GGGGAAAGCAAACTACCCTG -3'

Sequencing Primer
(F):5'- TTTCCCAGGCCCAAGTAAATATAG -3'
(R):5'- AGCAAACTACCCTGCCCATTTTATG -3'
Posted On 2022-10-06