Incidental Mutation 'R9702:Vps8'
ID 729637
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene Name VPS8 CORVET complex subunit
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 21241868-21463430 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21462883 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1383 (T1383A)
Ref Sequence ENSEMBL: ENSMUSP00000112937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053336] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
AlphaFold Q0P5W1
Predicted Effect probably benign
Transcript: ENSMUST00000053336
SMART Domains Protein: ENSMUSP00000062303
Gene: ENSMUSG00000043391

DomainStartEndE-ValueType
Pfam:UPF0524 12 248 1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096192
AA Change: T1355A

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: T1355A

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115397
AA Change: T1385A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: T1385A

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117598
AA Change: T1383A

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: T1383A

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118923
AA Change: T1355A

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: T1355A

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125487
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21,261,084 (GRCm39) missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21,267,162 (GRCm39) splice site probably benign
IGL00985:Vps8 APN 16 21,296,334 (GRCm39) splice site probably benign
IGL01356:Vps8 APN 16 21,336,107 (GRCm39) critical splice donor site probably null
IGL01375:Vps8 APN 16 21,378,122 (GRCm39) nonsense probably null
IGL01643:Vps8 APN 16 21,336,972 (GRCm39) missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21,285,234 (GRCm39) missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21,336,035 (GRCm39) missense probably damaging 1.00
IGL02465:Vps8 APN 16 21,340,653 (GRCm39) missense probably damaging 1.00
IGL02651:Vps8 APN 16 21,336,086 (GRCm39) missense probably damaging 0.99
IGL03174:Vps8 APN 16 21,285,213 (GRCm39) missense probably damaging 1.00
IGL03337:Vps8 APN 16 21,381,918 (GRCm39) missense probably benign
IGL03383:Vps8 APN 16 21,254,573 (GRCm39) critical splice donor site probably null
IGL03402:Vps8 APN 16 21,267,148 (GRCm39) missense possibly damaging 0.68
empires UTSW 16 21,400,298 (GRCm39) nonsense probably null
porky UTSW 16 21,279,988 (GRCm39) missense probably benign 0.32
realm UTSW 16 21,363,986 (GRCm39) intron probably benign
realms UTSW 16 21,262,938 (GRCm39) splice site probably null
Reich UTSW 16 21,297,189 (GRCm39) missense probably benign 0.29
reichen UTSW 16 21,325,575 (GRCm39) splice site probably benign
IGL03052:Vps8 UTSW 16 21,267,115 (GRCm39) missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21,319,084 (GRCm39) missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21,296,273 (GRCm39) missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21,296,273 (GRCm39) missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21,288,904 (GRCm39) missense probably benign 0.00
R0137:Vps8 UTSW 16 21,323,136 (GRCm39) splice site probably benign
R0362:Vps8 UTSW 16 21,426,977 (GRCm39) intron probably benign
R0384:Vps8 UTSW 16 21,325,575 (GRCm39) splice site probably benign
R0492:Vps8 UTSW 16 21,261,107 (GRCm39) missense probably damaging 1.00
R0525:Vps8 UTSW 16 21,358,859 (GRCm39) critical splice donor site probably null
R0531:Vps8 UTSW 16 21,278,561 (GRCm39) intron probably benign
R0605:Vps8 UTSW 16 21,378,087 (GRCm39) missense probably benign 0.00
R0636:Vps8 UTSW 16 21,253,683 (GRCm39) missense probably benign 0.32
R0707:Vps8 UTSW 16 21,261,107 (GRCm39) missense probably damaging 1.00
R0840:Vps8 UTSW 16 21,275,071 (GRCm39) missense probably damaging 0.99
R1170:Vps8 UTSW 16 21,278,570 (GRCm39) intron probably benign
R1203:Vps8 UTSW 16 21,330,307 (GRCm39) missense probably damaging 1.00
R1482:Vps8 UTSW 16 21,400,348 (GRCm39) missense probably benign 0.00
R1531:Vps8 UTSW 16 21,285,226 (GRCm39) nonsense probably null
R1642:Vps8 UTSW 16 21,400,329 (GRCm39) missense probably benign
R1956:Vps8 UTSW 16 21,279,892 (GRCm39) missense probably damaging 1.00
R2201:Vps8 UTSW 16 21,395,507 (GRCm39) missense probably damaging 1.00
R2287:Vps8 UTSW 16 21,387,163 (GRCm39) missense probably damaging 1.00
R2423:Vps8 UTSW 16 21,378,087 (GRCm39) missense probably benign 0.00
R3151:Vps8 UTSW 16 21,261,123 (GRCm39) missense probably benign 0.04
R3943:Vps8 UTSW 16 21,288,873 (GRCm39) missense probably damaging 1.00
R3944:Vps8 UTSW 16 21,288,873 (GRCm39) missense probably damaging 1.00
R4043:Vps8 UTSW 16 21,345,146 (GRCm39) missense probably damaging 1.00
R4302:Vps8 UTSW 16 21,314,664 (GRCm39) missense probably damaging 1.00
R4398:Vps8 UTSW 16 21,323,216 (GRCm39) missense probably damaging 1.00
R4477:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4478:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4479:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4480:Vps8 UTSW 16 21,363,986 (GRCm39) intron probably benign
R4571:Vps8 UTSW 16 21,254,525 (GRCm39) missense probably damaging 1.00
R4653:Vps8 UTSW 16 21,318,960 (GRCm39) missense probably damaging 1.00
R4664:Vps8 UTSW 16 21,262,938 (GRCm39) splice site probably null
R4713:Vps8 UTSW 16 21,261,189 (GRCm39) missense probably damaging 1.00
R4726:Vps8 UTSW 16 21,267,154 (GRCm39) splice site probably null
R4959:Vps8 UTSW 16 21,278,536 (GRCm39) missense probably damaging 1.00
R4973:Vps8 UTSW 16 21,278,536 (GRCm39) missense probably damaging 1.00
R4975:Vps8 UTSW 16 21,285,219 (GRCm39) missense probably damaging 1.00
R4992:Vps8 UTSW 16 21,280,158 (GRCm39) missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21,378,103 (GRCm39) missense probably damaging 1.00
R5168:Vps8 UTSW 16 21,351,849 (GRCm39) missense probably benign 0.05
R5168:Vps8 UTSW 16 21,276,195 (GRCm39) missense probably damaging 0.99
R5222:Vps8 UTSW 16 21,400,298 (GRCm39) nonsense probably null
R5231:Vps8 UTSW 16 21,395,475 (GRCm39) missense probably damaging 1.00
R5876:Vps8 UTSW 16 21,280,189 (GRCm39) critical splice donor site probably null
R5963:Vps8 UTSW 16 21,288,871 (GRCm39) missense possibly damaging 0.48
R6010:Vps8 UTSW 16 21,363,955 (GRCm39) intron probably benign
R6023:Vps8 UTSW 16 21,279,988 (GRCm39) missense probably benign 0.32
R6173:Vps8 UTSW 16 21,314,682 (GRCm39) splice site probably null
R6185:Vps8 UTSW 16 21,288,891 (GRCm39) missense probably damaging 0.98
R6264:Vps8 UTSW 16 21,378,099 (GRCm39) nonsense probably null
R6409:Vps8 UTSW 16 21,297,189 (GRCm39) missense probably benign 0.29
R6522:Vps8 UTSW 16 21,261,129 (GRCm39) missense probably damaging 0.99
R6528:Vps8 UTSW 16 21,372,875 (GRCm39) nonsense probably null
R6784:Vps8 UTSW 16 21,381,957 (GRCm39) missense probably benign 0.01
R7040:Vps8 UTSW 16 21,393,772 (GRCm39) missense probably damaging 1.00
R7072:Vps8 UTSW 16 21,400,329 (GRCm39) missense probably benign
R7103:Vps8 UTSW 16 21,345,191 (GRCm39) missense probably damaging 1.00
R7149:Vps8 UTSW 16 21,278,526 (GRCm39) missense probably damaging 1.00
R7195:Vps8 UTSW 16 21,275,032 (GRCm39) missense probably damaging 1.00
R7206:Vps8 UTSW 16 21,276,171 (GRCm39) missense probably damaging 1.00
R7403:Vps8 UTSW 16 21,253,722 (GRCm39) missense possibly damaging 0.78
R7782:Vps8 UTSW 16 21,330,308 (GRCm39) missense possibly damaging 0.89
R7806:Vps8 UTSW 16 21,278,501 (GRCm39) missense probably damaging 1.00
R7846:Vps8 UTSW 16 21,351,070 (GRCm39) missense probably benign 0.01
R7943:Vps8 UTSW 16 21,296,622 (GRCm39) missense possibly damaging 0.66
R8075:Vps8 UTSW 16 21,340,644 (GRCm39) missense probably damaging 0.99
R8190:Vps8 UTSW 16 21,393,780 (GRCm39) missense possibly damaging 0.73
R8307:Vps8 UTSW 16 21,314,652 (GRCm39) missense probably benign 0.02
R8483:Vps8 UTSW 16 21,393,763 (GRCm39) missense probably damaging 0.98
R8814:Vps8 UTSW 16 21,395,400 (GRCm39) missense probably damaging 1.00
R9064:Vps8 UTSW 16 21,288,979 (GRCm39) missense probably damaging 1.00
R9367:Vps8 UTSW 16 21,340,668 (GRCm39) missense possibly damaging 0.45
R9404:Vps8 UTSW 16 21,426,927 (GRCm39) missense probably benign 0.12
R9544:Vps8 UTSW 16 21,336,893 (GRCm39) missense probably benign 0.00
R9570:Vps8 UTSW 16 21,462,953 (GRCm39) missense probably benign 0.10
R9634:Vps8 UTSW 16 21,372,893 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATATGGGAGTTGTGCTGAG -3'
(R):5'- ATCTGCGGTCTGACCTGTAAC -3'

Sequencing Primer
(F):5'- ACAGAGGTGTGCCAGCAC -3'
(R):5'- AGAGGGTCCTTCCTGCCTC -3'
Posted On 2022-10-06