Incidental Mutation 'R9702:Rab11b'
ID 729638
Institutional Source Beutler Lab
Gene Symbol Rab11b
Ensembl Gene ENSMUSG00000077450
Gene Name RAB11B, member RAS oncogene family
Synonyms A730055L17Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 33961458-33979460 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 33968026 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 82 (R82L)
Ref Sequence ENSEMBL: ENSMUSP00000110021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057373] [ENSMUST00000173860] [ENSMUST00000173987]
AlphaFold P46638
Predicted Effect possibly damaging
Transcript: ENSMUST00000057373
AA Change: R82L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110021
Gene: ENSMUSG00000077450
AA Change: R82L

DomainStartEndE-ValueType
RAB 12 175 3.76e-115 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000134544
Gene: ENSMUSG00000077450
AA Change: R24L

DomainStartEndE-ValueType
RAB 2 118 3.53e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173860
AA Change: R57L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134448
Gene: ENSMUSG00000077450
AA Change: R57L

DomainStartEndE-ValueType
RAB 12 150 3.17e-81 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173987
AA Change: R82L

PolyPhen 2 Score 0.609 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000133921
Gene: ENSMUSG00000077450
AA Change: R82L

DomainStartEndE-ValueType
RAB 12 149 2.81e-82 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Crim1 T A 17: 78,681,516 (GRCm39) V990E probably damaging Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Rab11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Rab11b APN 17 33,968,790 (GRCm39) missense probably damaging 1.00
R1969:Rab11b UTSW 17 33,979,209 (GRCm39) missense probably damaging 1.00
R2096:Rab11b UTSW 17 33,967,976 (GRCm39) missense probably damaging 1.00
R2566:Rab11b UTSW 17 33,966,692 (GRCm39) missense probably benign 0.01
R3706:Rab11b UTSW 17 33,966,740 (GRCm39) missense probably benign
R4093:Rab11b UTSW 17 33,968,763 (GRCm39) missense possibly damaging 0.94
R5070:Rab11b UTSW 17 33,967,855 (GRCm39) missense probably damaging 1.00
R5218:Rab11b UTSW 17 33,967,924 (GRCm39) missense probably benign 0.03
R5306:Rab11b UTSW 17 33,979,243 (GRCm39) utr 5 prime probably benign
R7205:Rab11b UTSW 17 33,968,841 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGAGCACAGTCTGGC -3'
(R):5'- TTACTGAGCCCCAAATTCCC -3'

Sequencing Primer
(F):5'- TCAGAGCACAGTCTGGCATGTC -3'
(R):5'- GAGCCCCAAATTCCCTCCTCAG -3'
Posted On 2022-10-06