Incidental Mutation 'R9702:Crim1'
ID 729639
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 78200248-78376592 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78374087 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 990 (V990E)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070039] [ENSMUST00000112487] [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000070039
SMART Domains Protein: ENSMUSP00000068987
Gene: ENSMUSG00000056121

DomainStartEndE-ValueType
Pfam:FEZ 42 284 7.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112487
SMART Domains Protein: ENSMUSP00000108106
Gene: ENSMUSG00000056121

DomainStartEndE-ValueType
Pfam:FEZ 42 281 2.2e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112498
AA Change: V990E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: V990E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,216,552 Y746H probably damaging Het
Adgrv1 T A 13: 81,536,364 I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 R493H possibly damaging Het
Apob G T 12: 8,007,559 A2014S probably damaging Het
Bdnf A T 2: 109,723,772 M164L possibly damaging Het
Ccdc187 C T 2: 26,282,210 V287M unknown Het
Cd164 G A 10: 41,528,822 R192Q probably damaging Het
Cd84 T C 1: 171,872,931 V205A probably benign Het
Cfap161 T A 7: 83,793,444 M54L probably benign Het
Dsc1 A G 18: 20,094,628 F518L probably benign Het
Esyt1 G A 10: 128,520,738 S346L probably damaging Het
Fbxo30 G T 10: 11,290,638 C368F probably benign Het
Gas2l3 C T 10: 89,414,081 A392T probably benign Het
Gfra4 T A 2: 131,042,619 S22C probably benign Het
Gm11992 T G 11: 9,056,568 V166G probably benign Het
Gm14085 T A 2: 122,523,531 I546N probably damaging Het
Gp1bb A T 16: 18,621,134 L70Q probably damaging Het
Gtf2i T C 5: 134,246,561 T707A probably benign Het
Inpp5f A C 7: 128,676,791 D435A possibly damaging Het
Kynu T A 2: 43,589,457 M121K probably damaging Het
Ldb3 A G 14: 34,577,133 V178A probably benign Het
Lrrc31 A G 3: 30,681,077 L350P probably damaging Het
Mfsd14b C A 13: 65,073,600 V293L probably benign Het
Mrps23 C T 11: 88,210,172 T121M probably damaging Het
Nlrp4c T A 7: 6,065,802 V234E probably benign Het
Olfr585 T C 7: 103,098,136 Y132H probably damaging Het
Pign A T 1: 105,557,487 D782E probably damaging Het
Rab11b C A 17: 33,749,052 R82L possibly damaging Het
Sema3c T C 5: 17,653,830 S76P probably damaging Het
Sobp T C 10: 43,021,948 N547S probably benign Het
Tigd3 G A 19: 5,892,808 T98M probably damaging Het
Tox T G 4: 6,697,418 M462L probably benign Het
Vmn1r158 T A 7: 22,790,640 Q48L probably benign Het
Vps8 A G 16: 21,644,133 T1383A probably benign Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Zfp108 C T 7: 24,260,770 T262I probably benign Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6129:Crim1 UTSW 17 78281309 missense probably benign 0.17
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
R8782:Crim1 UTSW 17 78200877 missense probably damaging 1.00
R8961:Crim1 UTSW 17 78372688 missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78345980 missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78344442 missense probably damaging 1.00
R9250:Crim1 UTSW 17 78370042 missense probably benign
R9401:Crim1 UTSW 17 78350865 frame shift probably null
R9402:Crim1 UTSW 17 78350865 frame shift probably null
R9644:Crim1 UTSW 17 78280068 missense probably damaging 1.00
R9710:Crim1 UTSW 17 78303075 nonsense probably null
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTAAGACATCACGCCCCATGG -3'
(R):5'- AAGTGCGCAAATCCTAGTTTAC -3'

Sequencing Primer
(F):5'- TCACGCCCCATGGACACTAG -3'
(R):5'- AAAGAGCAGATTTTCGTCTTTCTCCG -3'
Posted On 2022-10-06