Incidental Mutation 'R9702:Crim1'
ID 729639
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Name cysteine rich transmembrane BMP regulator 1
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9702 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 78507677-78684021 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 78681516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 990 (V990E)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070039] [ENSMUST00000112487] [ENSMUST00000112498]
AlphaFold Q9JLL0
Predicted Effect probably benign
Transcript: ENSMUST00000070039
SMART Domains Protein: ENSMUSP00000068987
Gene: ENSMUSG00000056121

DomainStartEndE-ValueType
Pfam:FEZ 42 284 7.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112487
SMART Domains Protein: ENSMUSP00000108106
Gene: ENSMUSG00000056121

DomainStartEndE-ValueType
Pfam:FEZ 42 281 2.2e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112498
AA Change: V990E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: V990E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A G 11: 110,107,378 (GRCm39) Y746H probably damaging Het
Adgrv1 T A 13: 81,684,483 (GRCm39) I1073F possibly damaging Het
Ankrd6 C T 4: 32,810,202 (GRCm39) R493H possibly damaging Het
Apob G T 12: 8,057,559 (GRCm39) A2014S probably damaging Het
Bdnf A T 2: 109,554,117 (GRCm39) M164L possibly damaging Het
Ccdc187 C T 2: 26,172,222 (GRCm39) V287M unknown Het
Cd164 G A 10: 41,404,818 (GRCm39) R192Q probably damaging Het
Cd84 T C 1: 171,700,498 (GRCm39) V205A probably benign Het
Cfap161 T A 7: 83,442,652 (GRCm39) M54L probably benign Het
Dsc1 A G 18: 20,227,685 (GRCm39) F518L probably benign Het
Esyt1 G A 10: 128,356,607 (GRCm39) S346L probably damaging Het
Fbxo30 G T 10: 11,166,382 (GRCm39) C368F probably benign Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Gfra4 T A 2: 130,884,539 (GRCm39) S22C probably benign Het
Gm11992 T G 11: 9,006,568 (GRCm39) V166G probably benign Het
Gp1bb A T 16: 18,439,884 (GRCm39) L70Q probably damaging Het
Gtf2i T C 5: 134,275,415 (GRCm39) T707A probably benign Het
Inpp5f A C 7: 128,278,515 (GRCm39) D435A possibly damaging Het
Kynu T A 2: 43,479,469 (GRCm39) M121K probably damaging Het
Ldb3 A G 14: 34,299,090 (GRCm39) V178A probably benign Het
Lrrc31 A G 3: 30,735,226 (GRCm39) L350P probably damaging Het
Mfsd14b C A 13: 65,221,414 (GRCm39) V293L probably benign Het
Mrps23 C T 11: 88,100,998 (GRCm39) T121M probably damaging Het
Nlrp4c T A 7: 6,068,801 (GRCm39) V234E probably benign Het
Or51f1e T C 7: 102,747,343 (GRCm39) Y132H probably damaging Het
Pign A T 1: 105,485,212 (GRCm39) D782E probably damaging Het
Rab11b C A 17: 33,968,026 (GRCm39) R82L possibly damaging Het
Sema3c T C 5: 17,858,828 (GRCm39) S76P probably damaging Het
Slc28a2b T A 2: 122,354,012 (GRCm39) I546N probably damaging Het
Sobp T C 10: 42,897,944 (GRCm39) N547S probably benign Het
Tigd3 G A 19: 5,942,836 (GRCm39) T98M probably damaging Het
Tox T G 4: 6,697,418 (GRCm39) M462L probably benign Het
Vmn1r158 T A 7: 22,490,065 (GRCm39) Q48L probably benign Het
Vps8 A G 16: 21,462,883 (GRCm39) T1383A probably benign Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Zfp108 C T 7: 23,960,195 (GRCm39) T262I probably benign Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78,677,520 (GRCm39) missense probably damaging 1.00
IGL01090:Crim1 APN 17 78,654,658 (GRCm39) missense probably damaging 0.97
IGL01490:Crim1 APN 17 78,642,725 (GRCm39) missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78,651,863 (GRCm39) missense probably benign 0.09
IGL01769:Crim1 APN 17 78,620,664 (GRCm39) missense probably benign 0.02
IGL02004:Crim1 APN 17 78,680,004 (GRCm39) splice site probably benign
IGL02211:Crim1 APN 17 78,662,574 (GRCm39) missense probably damaging 1.00
IGL02275:Crim1 APN 17 78,677,427 (GRCm39) missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78,623,083 (GRCm39) missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78,642,763 (GRCm39) nonsense probably null
IGL02453:Crim1 APN 17 78,651,913 (GRCm39) missense probably damaging 1.00
IGL02481:Crim1 APN 17 78,658,227 (GRCm39) missense probably damaging 0.98
IGL02632:Crim1 APN 17 78,680,103 (GRCm39) missense probably benign 0.08
IGL02652:Crim1 APN 17 78,623,106 (GRCm39) missense probably damaging 1.00
IGL02696:Crim1 APN 17 78,587,402 (GRCm39) missense probably damaging 0.96
IGL02811:Crim1 APN 17 78,658,130 (GRCm39) missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78,623,179 (GRCm39) splice site probably benign
IGL03349:Crim1 APN 17 78,662,579 (GRCm39) nonsense probably null
bugeye UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78,675,227 (GRCm39) missense probably benign 0.00
R0227:Crim1 UTSW 17 78,651,938 (GRCm39) splice site probably benign
R0458:Crim1 UTSW 17 78,620,655 (GRCm39) missense probably damaging 0.98
R0482:Crim1 UTSW 17 78,680,008 (GRCm39) missense probably benign 0.00
R0989:Crim1 UTSW 17 78,508,373 (GRCm39) missense probably benign 0.21
R1266:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
R1529:Crim1 UTSW 17 78,675,383 (GRCm39) missense probably benign
R1679:Crim1 UTSW 17 78,508,228 (GRCm39) missense probably benign 0.27
R1909:Crim1 UTSW 17 78,620,556 (GRCm39) missense probably benign 0.26
R2273:Crim1 UTSW 17 78,662,608 (GRCm39) critical splice donor site probably null
R3899:Crim1 UTSW 17 78,588,783 (GRCm39) missense probably benign 0.00
R3909:Crim1 UTSW 17 78,588,668 (GRCm39) splice site probably benign
R4092:Crim1 UTSW 17 78,658,265 (GRCm39) missense probably damaging 1.00
R4154:Crim1 UTSW 17 78,545,272 (GRCm39) missense probably benign 0.01
R4687:Crim1 UTSW 17 78,610,454 (GRCm39) missense probably damaging 1.00
R5022:Crim1 UTSW 17 78,587,558 (GRCm39) missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78,588,776 (GRCm39) missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78,681,519 (GRCm39) missense probably damaging 1.00
R5284:Crim1 UTSW 17 78,620,695 (GRCm39) missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78,545,236 (GRCm39) missense probably damaging 1.00
R5635:Crim1 UTSW 17 78,623,070 (GRCm39) missense probably damaging 1.00
R5686:Crim1 UTSW 17 78,681,512 (GRCm39) missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78,623,146 (GRCm39) missense probably damaging 1.00
R6117:Crim1 UTSW 17 78,610,517 (GRCm39) missense probably damaging 1.00
R6129:Crim1 UTSW 17 78,588,738 (GRCm39) missense probably benign 0.17
R6265:Crim1 UTSW 17 78,677,514 (GRCm39) missense probably benign 0.01
R6812:Crim1 UTSW 17 78,623,029 (GRCm39) missense probably damaging 1.00
R6858:Crim1 UTSW 17 78,623,056 (GRCm39) missense probably damaging 1.00
R7920:Crim1 UTSW 17 78,610,493 (GRCm39) missense probably damaging 1.00
R8022:Crim1 UTSW 17 78,622,984 (GRCm39) missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78,654,686 (GRCm39) missense probably benign 0.00
R8782:Crim1 UTSW 17 78,508,306 (GRCm39) missense probably damaging 1.00
R8961:Crim1 UTSW 17 78,680,117 (GRCm39) missense possibly damaging 0.65
R8971:Crim1 UTSW 17 78,653,409 (GRCm39) missense possibly damaging 0.89
R9245:Crim1 UTSW 17 78,651,871 (GRCm39) missense probably damaging 1.00
R9250:Crim1 UTSW 17 78,677,471 (GRCm39) missense probably benign
R9401:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9402:Crim1 UTSW 17 78,658,294 (GRCm39) frame shift probably null
R9644:Crim1 UTSW 17 78,587,497 (GRCm39) missense probably damaging 1.00
R9710:Crim1 UTSW 17 78,610,504 (GRCm39) nonsense probably null
X0064:Crim1 UTSW 17 78,508,262 (GRCm39) small deletion probably benign
Z1088:Crim1 UTSW 17 78,675,264 (GRCm39) missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TTAAGACATCACGCCCCATGG -3'
(R):5'- AAGTGCGCAAATCCTAGTTTAC -3'

Sequencing Primer
(F):5'- TCACGCCCCATGGACACTAG -3'
(R):5'- AAAGAGCAGATTTTCGTCTTTCTCCG -3'
Posted On 2022-10-06