Mutagenetix > Incidental Mutation

Incidental Mutation 'R9702:Crim1'

729639

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9702 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 78374087 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 990 (V990E)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070039] [ENSMUST00000112487] [ENSMUST00000112498]

AlphaFold

Q9JLL0

Predicted Effect

probably benign
Transcript: ENSMUST00000070039

SMART Domains

Protein: ENSMUSP00000068987
Gene: ENSMUSG00000056121

Domain	Start	End	E-Value	Type
Pfam:FEZ	42	284	7.2e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112487

SMART Domains

Protein: ENSMUSP00000108106
Gene: ENSMUSG00000056121

Domain	Start	End	E-Value	Type
Pfam:FEZ	42	281	2.2e-96	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000112498
AA Change: V990E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: V990E

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca6	A	G	11: 110,216,552	Y746H	probably damaging	Het
Adgrv1	T	A	13: 81,536,364	I1073F	possibly damaging	Het
Ankrd6	C	T	4: 32,810,202	R493H	possibly damaging	Het
Apob	G	T	12: 8,007,559	A2014S	probably damaging	Het
Bdnf	A	T	2: 109,723,772	M164L	possibly damaging	Het
Ccdc187	C	T	2: 26,282,210	V287M	unknown	Het
Cd164	G	A	10: 41,528,822	R192Q	probably damaging	Het
Cd84	T	C	1: 171,872,931	V205A	probably benign	Het
Cfap161	T	A	7: 83,793,444	M54L	probably benign	Het
Dsc1	A	G	18: 20,094,628	F518L	probably benign	Het
Esyt1	G	A	10: 128,520,738	S346L	probably damaging	Het
Fbxo30	G	T	10: 11,290,638	C368F	probably benign	Het
Gas2l3	C	T	10: 89,414,081	A392T	probably benign	Het
Gfra4	T	A	2: 131,042,619	S22C	probably benign	Het
Gm11992	T	G	11: 9,056,568	V166G	probably benign	Het
Gm14085	T	A	2: 122,523,531	I546N	probably damaging	Het
Gp1bb	A	T	16: 18,621,134	L70Q	probably damaging	Het
Gtf2i	T	C	5: 134,246,561	T707A	probably benign	Het
Inpp5f	A	C	7: 128,676,791	D435A	possibly damaging	Het
Kynu	T	A	2: 43,589,457	M121K	probably damaging	Het
Ldb3	A	G	14: 34,577,133	V178A	probably benign	Het
Lrrc31	A	G	3: 30,681,077	L350P	probably damaging	Het
Mfsd14b	C	A	13: 65,073,600	V293L	probably benign	Het
Mrps23	C	T	11: 88,210,172	T121M	probably damaging	Het
Nlrp4c	T	A	7: 6,065,802	V234E	probably benign	Het
Olfr585	T	C	7: 103,098,136	Y132H	probably damaging	Het
Pign	A	T	1: 105,557,487	D782E	probably damaging	Het
Rab11b	C	A	17: 33,749,052	R82L	possibly damaging	Het
Sema3c	T	C	5: 17,653,830	S76P	probably damaging	Het
Sobp	T	C	10: 43,021,948	N547S	probably benign	Het
Tigd3	G	A	19: 5,892,808	T98M	probably damaging	Het
Tox	T	G	4: 6,697,418	M462L	probably benign	Het
Vmn1r158	T	A	7: 22,790,640	Q48L	probably benign	Het
Vps8	A	G	16: 21,644,133	T1383A	probably benign	Het
Vwa1	G	A	4: 155,772,879	P154L	probably damaging	Het
Zfp108	C	T	7: 24,260,770	T262I	probably benign	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
R8971:Crim1	UTSW	17	78345980	missense	possibly damaging	0.89
R9245:Crim1	UTSW	17	78344442	missense	probably damaging	1.00
R9250:Crim1	UTSW	17	78370042	missense	probably benign
R9401:Crim1	UTSW	17	78350865	frame shift	probably null
R9402:Crim1	UTSW	17	78350865	frame shift	probably null
R9644:Crim1	UTSW	17	78280068	missense	probably damaging	1.00
R9710:Crim1	UTSW	17	78303075	nonsense	probably null
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TTAAGACATCACGCCCCATGG -3'
(R):5'- AAGTGCGCAAATCCTAGTTTAC -3'

Sequencing Primer
(F):5'- TCACGCCCCATGGACACTAG -3'
(R):5'- AAAGAGCAGATTTTCGTCTTTCTCCG -3'

Posted On

2022-10-06