Incidental Mutation 'R9703:Ovch2'
ID 729660
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms 9230106D23Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9703 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107380751-107400386 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107383777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 523 (I523F)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: I523F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: I523F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 41,248,971 (GRCm39) N360K probably damaging Het
Aoc1l2 A G 6: 48,909,629 (GRCm39) T625A probably benign Het
Apob T A 12: 8,030,507 (GRCm39) L82Q probably damaging Het
Arhgap30 T G 1: 171,235,339 (GRCm39) L571R probably damaging Het
Atg9a C T 1: 75,162,431 (GRCm39) C493Y probably damaging Het
Brip1 T C 11: 85,952,830 (GRCm39) T984A possibly damaging Het
Btbd9 A G 17: 30,749,200 (GRCm39) V38A possibly damaging Het
Crocc2 C A 1: 93,130,444 (GRCm39) D908E probably benign Het
Crybg3 C G 16: 59,375,939 (GRCm39) A58P probably damaging Het
Cts7 T C 13: 61,504,350 (GRCm39) N71S probably damaging Het
Ddx46 A G 13: 55,824,635 (GRCm39) Y962C probably damaging Het
Dock10 G A 1: 80,517,540 (GRCm39) R1373C probably damaging Het
Dock9 A T 14: 121,781,989 (GRCm39) *2043R probably null Het
Efs A T 14: 55,156,871 (GRCm39) V388E possibly damaging Het
Esyt1 C T 10: 128,354,796 (GRCm39) probably null Het
Extl3 G T 14: 65,292,103 (GRCm39) R907S probably damaging Het
Fcgbp G A 7: 27,806,400 (GRCm39) V2123M probably damaging Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Golm1 A T 13: 59,797,433 (GRCm39) D137E probably benign Het
Grxcr2 T C 18: 42,124,988 (GRCm39) D140G possibly damaging Het
H2ac19 G A 3: 96,147,557 (GRCm39) R4C probably benign Het
Hrh1 G A 6: 114,457,979 (GRCm39) C420Y probably benign Het
Ints13 A T 6: 146,459,063 (GRCm39) L316Q probably damaging Het
Iws1 T A 18: 32,212,738 (GRCm39) D55E probably damaging Het
Kcnrg CACAACAA CACAA 14: 61,845,009 (GRCm39) probably benign Het
Klrc2 G C 6: 129,633,407 (GRCm39) S215* probably null Het
Muc5b A G 7: 141,425,535 (GRCm39) T4727A possibly damaging Het
Nsd3 T C 8: 26,131,228 (GRCm39) S198P probably benign Het
Or2n1b A T 17: 38,459,856 (GRCm39) I126F possibly damaging Het
Or6c214 A T 10: 129,591,286 (GRCm39) I11N possibly damaging Het
Pals1 T A 12: 78,843,850 (GRCm39) I18K probably benign Het
Pcdhb1 T A 18: 37,399,019 (GRCm39) D323E probably damaging Het
Pfkl T A 10: 77,826,142 (GRCm39) probably null Het
Pigc T A 1: 161,798,176 (GRCm39) F53I probably benign Het
Pramel29 T A 4: 143,939,510 (GRCm39) D9V probably damaging Het
Prph2 G A 17: 47,234,447 (GRCm39) A339T unknown Het
Prrc2a T C 17: 35,378,320 (GRCm39) K452E unknown Het
Rab36 T C 10: 74,886,474 (GRCm39) W151R possibly damaging Het
Sdk1 A G 5: 142,100,283 (GRCm39) T1438A possibly damaging Het
Slc25a17 A T 15: 81,224,193 (GRCm39) I55K probably damaging Het
Smg1 A T 7: 117,739,744 (GRCm39) I3401N possibly damaging Het
Smpd3 T A 8: 106,991,713 (GRCm39) H280L probably damaging Het
Srsf10 A G 4: 135,591,153 (GRCm39) H202R probably benign Het
Swap70 C T 7: 109,872,512 (GRCm39) R376C probably damaging Het
Syde1 G T 10: 78,421,557 (GRCm39) L665M probably damaging Het
Tha1 A G 11: 117,761,863 (GRCm39) V126A probably damaging Het
Tln2 T C 9: 67,293,938 (GRCm39) H230R probably damaging Het
Tnc G A 4: 63,889,412 (GRCm39) A1698V probably benign Het
Twist2 C A 1: 91,729,744 (GRCm39) S132R probably damaging Het
Ubr1 C T 2: 120,732,092 (GRCm39) C1170Y probably damaging Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107,388,297 (GRCm39) missense probably null 1.00
IGL02198:Ovch2 APN 7 107,394,041 (GRCm39) missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107,394,030 (GRCm39) missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107,395,755 (GRCm39) missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107,389,405 (GRCm39) missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107,394,138 (GRCm39) missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107,400,343 (GRCm39) missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107,381,243 (GRCm39) missense probably benign
R0631:Ovch2 UTSW 7 107,381,228 (GRCm39) missense probably benign 0.01
R1028:Ovch2 UTSW 7 107,395,755 (GRCm39) missense probably benign 0.37
R1329:Ovch2 UTSW 7 107,384,653 (GRCm39) missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107,389,412 (GRCm39) critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107,389,402 (GRCm39) missense probably benign 0.02
R2265:Ovch2 UTSW 7 107,383,782 (GRCm39) missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107,394,122 (GRCm39) missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107,384,699 (GRCm39) missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107,395,775 (GRCm39) missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107,395,755 (GRCm39) missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107,391,341 (GRCm39) missense probably benign 0.26
R5353:Ovch2 UTSW 7 107,393,631 (GRCm39) missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107,393,201 (GRCm39) missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107,392,606 (GRCm39) missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107,381,185 (GRCm39) missense probably benign
R5979:Ovch2 UTSW 7 107,393,595 (GRCm39) missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107,395,779 (GRCm39) missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107,384,648 (GRCm39) missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107,388,301 (GRCm39) missense probably benign 0.17
R6877:Ovch2 UTSW 7 107,389,315 (GRCm39) missense probably benign 0.25
R7040:Ovch2 UTSW 7 107,395,772 (GRCm39) missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107,393,640 (GRCm39) missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107,393,577 (GRCm39) missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107,388,295 (GRCm39) critical splice donor site probably null
R7841:Ovch2 UTSW 7 107,393,298 (GRCm39) missense probably benign 0.01
R7908:Ovch2 UTSW 7 107,388,326 (GRCm39) missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107,393,207 (GRCm39) missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107,389,584 (GRCm39) missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107,393,251 (GRCm39) nonsense probably null
R8812:Ovch2 UTSW 7 107,392,462 (GRCm39) missense probably damaging 1.00
R9250:Ovch2 UTSW 7 107,392,542 (GRCm39) missense probably damaging 1.00
R9301:Ovch2 UTSW 7 107,395,815 (GRCm39) missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107,389,560 (GRCm39) missense probably benign 0.03
R9717:Ovch2 UTSW 7 107,393,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCAGCTACCAGTAAAGAGC -3'
(R):5'- CACATTTTGAAGAGGCAGATCC -3'

Sequencing Primer
(F):5'- TACCAGTAAAGAGCTTCAGTGGTGTC -3'
(R):5'- TACATCACTCAACCTGCCT -3'
Posted On 2022-10-06