Incidental Mutation 'R9703:Ovch2'
ID 729660
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R9703 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107781544-107801208 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 107784570 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 523 (I523F)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: I523F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: I523F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,695 T625A probably benign Het
Adam20 T A 8: 40,795,934 N360K probably damaging Het
Apob T A 12: 7,980,507 L82Q probably damaging Het
Arhgap30 T G 1: 171,407,771 L571R probably damaging Het
Atg9a C T 1: 75,185,787 C493Y probably damaging Het
Brip1 T C 11: 86,062,004 T984A possibly damaging Het
Btbd9 A G 17: 30,530,226 V38A possibly damaging Het
C87977 T A 4: 144,212,940 D9V probably damaging Het
Crocc2 C A 1: 93,202,722 D908E probably benign Het
Crybg3 C G 16: 59,555,576 A58P probably damaging Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Ddx46 A G 13: 55,676,822 Y962C probably damaging Het
Dock10 G A 1: 80,539,823 R1373C probably damaging Het
Dock9 A T 14: 121,544,577 *2043R probably null Het
Efs A T 14: 54,919,414 V388E possibly damaging Het
Esyt1 C T 10: 128,518,927 probably null Het
Extl3 G T 14: 65,054,654 R907S probably damaging Het
Fcgbp G A 7: 28,106,975 V2123M probably damaging Het
Gas2l3 C T 10: 89,414,081 A392T probably benign Het
Golm1 A T 13: 59,649,619 D137E probably benign Het
Grxcr2 T C 18: 41,991,923 D140G possibly damaging Het
Hist2h2aa2 G A 3: 96,240,241 R4C probably benign Het
Hrh1 G A 6: 114,481,018 C420Y probably benign Het
Ints13 A T 6: 146,557,565 L316Q probably damaging Het
Iws1 T A 18: 32,079,685 D55E probably damaging Het
Kcnrg CACAACAA CACAA 14: 61,607,560 probably benign Het
Klrc2 G C 6: 129,656,444 S215* probably null Het
Mpp5 T A 12: 78,797,076 I18K probably benign Het
Muc5b A G 7: 141,871,798 T4727A possibly damaging Het
Nsd3 T C 8: 25,641,212 S198P probably benign Het
Olfr133 A T 17: 38,148,965 I126F possibly damaging Het
Olfr807 A T 10: 129,755,417 I11N possibly damaging Het
Pcdhb1 T A 18: 37,265,966 D323E probably damaging Het
Pfkl T A 10: 77,990,308 probably null Het
Pigc T A 1: 161,970,607 F53I probably benign Het
Prph2 G A 17: 46,923,521 A339T unknown Het
Prrc2a T C 17: 35,159,344 K452E unknown Het
Rab36 T C 10: 75,050,642 W151R possibly damaging Het
Sdk1 A G 5: 142,114,528 T1438A possibly damaging Het
Slc25a17 A T 15: 81,339,992 I55K probably damaging Het
Smg1 A T 7: 118,140,521 I3401N possibly damaging Het
Smpd3 T A 8: 106,265,081 H280L probably damaging Het
Srsf10 A G 4: 135,863,842 H202R probably benign Het
Swap70 C T 7: 110,273,305 R376C probably damaging Het
Syde1 G T 10: 78,585,723 L665M probably damaging Het
Tha1 A G 11: 117,871,037 V126A probably damaging Het
Tln2 T C 9: 67,386,656 H230R probably damaging Het
Tnc G A 4: 63,971,175 A1698V probably benign Het
Twist2 C A 1: 91,802,022 S132R probably damaging Het
Ubr1 C T 2: 120,901,611 C1170Y probably damaging Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107789090 missense probably null 1.00
IGL02198:Ovch2 APN 7 107794834 missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107794823 missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107796548 missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107790198 missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107794931 missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107801136 missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107782036 missense probably benign
R0631:Ovch2 UTSW 7 107782021 missense probably benign 0.01
R1028:Ovch2 UTSW 7 107796548 missense probably benign 0.37
R1329:Ovch2 UTSW 7 107785446 missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107790205 critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107790195 missense probably benign 0.02
R2265:Ovch2 UTSW 7 107784575 missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107794915 missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107790389 missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107785492 missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107796568 missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107796548 missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107792134 missense probably benign 0.26
R5353:Ovch2 UTSW 7 107794424 missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107793994 missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107793399 missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107781978 missense probably benign
R5979:Ovch2 UTSW 7 107794388 missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107789111 missense probably damaging 0.99
R6064:Ovch2 UTSW 7 107796572 missense probably damaging 0.98
R6247:Ovch2 UTSW 7 107785441 missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107789094 missense probably benign 0.17
R6877:Ovch2 UTSW 7 107790108 missense probably benign 0.25
R7040:Ovch2 UTSW 7 107796565 missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107794433 missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107794370 missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107789088 critical splice donor site probably null
R7841:Ovch2 UTSW 7 107794091 missense probably benign 0.01
R7908:Ovch2 UTSW 7 107789119 missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107794000 missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107790377 missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107793255 missense probably damaging 1.00
R8812:Ovch2 UTSW 7 107794044 nonsense probably null
R9250:Ovch2 UTSW 7 107793335 missense probably damaging 1.00
R9301:Ovch2 UTSW 7 107796608 missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107790353 missense probably benign 0.03
R9717:Ovch2 UTSW 7 107794377 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCAGCTACCAGTAAAGAGC -3'
(R):5'- CACATTTTGAAGAGGCAGATCC -3'

Sequencing Primer
(F):5'- TACCAGTAAAGAGCTTCAGTGGTGTC -3'
(R):5'- TACATCACTCAACCTGCCT -3'
Posted On 2022-10-06