Incidental Mutation 'R9703:Dock9'
ID 729684
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Name dedicator of cytokinesis 9
Synonyms D14Wsu89e, B230309H04Rik, Zizimin1
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9703 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 121779458-122035249 bp(-) (GRCm39)
Type of Mutation makesense
DNA Base Change (assembly) A to T at 121781989 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Stop codon to Arginine at position 2043 (*2043R)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000040700
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212181
Predicted Effect probably null
Transcript: ENSMUST00000212376
AA Change: *2043R
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T A 8: 41,248,971 (GRCm39) N360K probably damaging Het
Aoc1l2 A G 6: 48,909,629 (GRCm39) T625A probably benign Het
Apob T A 12: 8,030,507 (GRCm39) L82Q probably damaging Het
Arhgap30 T G 1: 171,235,339 (GRCm39) L571R probably damaging Het
Atg9a C T 1: 75,162,431 (GRCm39) C493Y probably damaging Het
Brip1 T C 11: 85,952,830 (GRCm39) T984A possibly damaging Het
Btbd9 A G 17: 30,749,200 (GRCm39) V38A possibly damaging Het
Crocc2 C A 1: 93,130,444 (GRCm39) D908E probably benign Het
Crybg3 C G 16: 59,375,939 (GRCm39) A58P probably damaging Het
Cts7 T C 13: 61,504,350 (GRCm39) N71S probably damaging Het
Ddx46 A G 13: 55,824,635 (GRCm39) Y962C probably damaging Het
Dock10 G A 1: 80,517,540 (GRCm39) R1373C probably damaging Het
Efs A T 14: 55,156,871 (GRCm39) V388E possibly damaging Het
Esyt1 C T 10: 128,354,796 (GRCm39) probably null Het
Extl3 G T 14: 65,292,103 (GRCm39) R907S probably damaging Het
Fcgbp G A 7: 27,806,400 (GRCm39) V2123M probably damaging Het
Gas2l3 C T 10: 89,249,943 (GRCm39) A392T probably benign Het
Golm1 A T 13: 59,797,433 (GRCm39) D137E probably benign Het
Grxcr2 T C 18: 42,124,988 (GRCm39) D140G possibly damaging Het
H2ac19 G A 3: 96,147,557 (GRCm39) R4C probably benign Het
Hrh1 G A 6: 114,457,979 (GRCm39) C420Y probably benign Het
Ints13 A T 6: 146,459,063 (GRCm39) L316Q probably damaging Het
Iws1 T A 18: 32,212,738 (GRCm39) D55E probably damaging Het
Kcnrg CACAACAA CACAA 14: 61,845,009 (GRCm39) probably benign Het
Klrc2 G C 6: 129,633,407 (GRCm39) S215* probably null Het
Muc5b A G 7: 141,425,535 (GRCm39) T4727A possibly damaging Het
Nsd3 T C 8: 26,131,228 (GRCm39) S198P probably benign Het
Or2n1b A T 17: 38,459,856 (GRCm39) I126F possibly damaging Het
Or6c214 A T 10: 129,591,286 (GRCm39) I11N possibly damaging Het
Ovch2 T A 7: 107,383,777 (GRCm39) I523F probably damaging Het
Pals1 T A 12: 78,843,850 (GRCm39) I18K probably benign Het
Pcdhb1 T A 18: 37,399,019 (GRCm39) D323E probably damaging Het
Pfkl T A 10: 77,826,142 (GRCm39) probably null Het
Pigc T A 1: 161,798,176 (GRCm39) F53I probably benign Het
Pramel29 T A 4: 143,939,510 (GRCm39) D9V probably damaging Het
Prph2 G A 17: 47,234,447 (GRCm39) A339T unknown Het
Prrc2a T C 17: 35,378,320 (GRCm39) K452E unknown Het
Rab36 T C 10: 74,886,474 (GRCm39) W151R possibly damaging Het
Sdk1 A G 5: 142,100,283 (GRCm39) T1438A possibly damaging Het
Slc25a17 A T 15: 81,224,193 (GRCm39) I55K probably damaging Het
Smg1 A T 7: 117,739,744 (GRCm39) I3401N possibly damaging Het
Smpd3 T A 8: 106,991,713 (GRCm39) H280L probably damaging Het
Srsf10 A G 4: 135,591,153 (GRCm39) H202R probably benign Het
Swap70 C T 7: 109,872,512 (GRCm39) R376C probably damaging Het
Syde1 G T 10: 78,421,557 (GRCm39) L665M probably damaging Het
Tha1 A G 11: 117,761,863 (GRCm39) V126A probably damaging Het
Tln2 T C 9: 67,293,938 (GRCm39) H230R probably damaging Het
Tnc G A 4: 63,889,412 (GRCm39) A1698V probably benign Het
Twist2 C A 1: 91,729,744 (GRCm39) S132R probably damaging Het
Ubr1 C T 2: 120,732,092 (GRCm39) C1170Y probably damaging Het
Vwa1 G A 4: 155,857,336 (GRCm39) P154L probably damaging Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121,905,880 (GRCm39) missense probably benign 0.12
IGL00817:Dock9 APN 14 121,935,703 (GRCm39) missense probably damaging 0.96
IGL00923:Dock9 APN 14 121,844,504 (GRCm39) unclassified probably benign
IGL01385:Dock9 APN 14 121,817,995 (GRCm39) missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121,890,496 (GRCm39) missense probably damaging 1.00
IGL01767:Dock9 APN 14 121,860,282 (GRCm39) missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121,796,440 (GRCm39) missense probably damaging 1.00
IGL02512:Dock9 APN 14 121,856,950 (GRCm39) splice site probably benign
IGL02525:Dock9 APN 14 121,877,538 (GRCm39) missense probably damaging 1.00
IGL02550:Dock9 APN 14 121,935,724 (GRCm39) start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121,862,559 (GRCm39) splice site probably benign
IGL02666:Dock9 APN 14 121,818,111 (GRCm39) missense probably benign 0.42
IGL02674:Dock9 APN 14 121,833,023 (GRCm39) splice site probably null
IGL02795:Dock9 APN 14 121,877,390 (GRCm39) missense probably benign 0.04
IGL03074:Dock9 APN 14 121,844,682 (GRCm39) missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121,876,940 (GRCm39) missense probably damaging 1.00
IGL03294:Dock9 APN 14 121,879,035 (GRCm39) splice site probably benign
R0036:Dock9 UTSW 14 121,860,265 (GRCm39) missense probably damaging 1.00
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0050:Dock9 UTSW 14 121,844,637 (GRCm39) missense probably benign 0.43
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0164:Dock9 UTSW 14 121,835,077 (GRCm39) missense probably damaging 1.00
R0270:Dock9 UTSW 14 121,813,411 (GRCm39) missense probably benign 0.02
R0494:Dock9 UTSW 14 121,899,996 (GRCm39) missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121,889,180 (GRCm39) nonsense probably null
R1029:Dock9 UTSW 14 121,837,096 (GRCm39) splice site probably null
R1214:Dock9 UTSW 14 121,823,728 (GRCm39) missense probably benign 0.02
R1231:Dock9 UTSW 14 121,813,362 (GRCm39) missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121,783,476 (GRCm39) missense probably damaging 1.00
R1629:Dock9 UTSW 14 121,780,986 (GRCm39) missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121,889,187 (GRCm39) missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121,864,292 (GRCm39) missense probably benign 0.01
R1772:Dock9 UTSW 14 121,847,210 (GRCm39) missense probably benign 0.07
R1855:Dock9 UTSW 14 121,877,571 (GRCm39) missense probably damaging 1.00
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1888:Dock9 UTSW 14 121,862,617 (GRCm39) missense probably benign 0.18
R1901:Dock9 UTSW 14 121,862,565 (GRCm39) splice site probably null
R1920:Dock9 UTSW 14 121,820,792 (GRCm39) missense probably damaging 1.00
R1987:Dock9 UTSW 14 121,829,242 (GRCm39) missense probably benign 0.00
R3035:Dock9 UTSW 14 121,844,249 (GRCm39) missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121,866,498 (GRCm39) splice site probably null
R4020:Dock9 UTSW 14 121,844,267 (GRCm39) missense probably benign 0.00
R4021:Dock9 UTSW 14 121,864,324 (GRCm39) missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121,820,883 (GRCm39) missense probably damaging 1.00
R4258:Dock9 UTSW 14 121,818,854 (GRCm39) missense probably benign 0.00
R4423:Dock9 UTSW 14 121,799,465 (GRCm39) critical splice donor site probably null
R4561:Dock9 UTSW 14 121,796,419 (GRCm39) missense probably benign 0.01
R4604:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R4646:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4647:Dock9 UTSW 14 121,823,658 (GRCm39) missense probably damaging 1.00
R4776:Dock9 UTSW 14 121,847,509 (GRCm39) missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121,784,008 (GRCm39) missense probably benign 0.37
R4865:Dock9 UTSW 14 121,780,917 (GRCm39) makesense probably null
R4951:Dock9 UTSW 14 121,890,547 (GRCm39) missense probably benign 0.35
R5151:Dock9 UTSW 14 121,815,582 (GRCm39) missense probably damaging 1.00
R5359:Dock9 UTSW 14 121,890,472 (GRCm39) missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121,815,615 (GRCm39) missense probably damaging 1.00
R5502:Dock9 UTSW 14 121,847,594 (GRCm39) splice site probably null
R5579:Dock9 UTSW 14 121,837,107 (GRCm39) missense probably damaging 1.00
R5753:Dock9 UTSW 14 121,872,037 (GRCm39) missense probably benign 0.05
R5836:Dock9 UTSW 14 121,918,763 (GRCm39) missense probably damaging 1.00
R5858:Dock9 UTSW 14 121,866,204 (GRCm39) missense probably benign 0.00
R5890:Dock9 UTSW 14 121,905,820 (GRCm39) critical splice donor site probably null
R6075:Dock9 UTSW 14 121,783,385 (GRCm39) missense probably benign
R6298:Dock9 UTSW 14 121,872,006 (GRCm39) missense probably damaging 1.00
R6306:Dock9 UTSW 14 121,799,492 (GRCm39) missense probably damaging 1.00
R6321:Dock9 UTSW 14 121,783,433 (GRCm39) missense probably damaging 1.00
R6330:Dock9 UTSW 14 121,842,655 (GRCm39) start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121,847,439 (GRCm39) missense probably damaging 1.00
R6784:Dock9 UTSW 14 121,780,926 (GRCm39) missense probably damaging 1.00
R6826:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6830:Dock9 UTSW 14 121,860,330 (GRCm39) missense probably damaging 1.00
R6838:Dock9 UTSW 14 121,784,008 (GRCm39) missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121,823,676 (GRCm39) missense probably benign 0.37
R6919:Dock9 UTSW 14 121,880,564 (GRCm39) missense probably benign 0.42
R6989:Dock9 UTSW 14 121,864,791 (GRCm39) missense probably damaging 1.00
R7539:Dock9 UTSW 14 121,818,848 (GRCm39) missense probably damaging 1.00
R7645:Dock9 UTSW 14 121,835,075 (GRCm39) missense probably benign 0.44
R7875:Dock9 UTSW 14 121,863,396 (GRCm39) nonsense probably null
R7900:Dock9 UTSW 14 121,783,491 (GRCm39) missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121,889,206 (GRCm39) missense probably benign 0.06
R8420:Dock9 UTSW 14 121,783,454 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,918,847 (GRCm39) missense probably damaging 1.00
R8511:Dock9 UTSW 14 121,864,801 (GRCm39) missense probably benign 0.40
R8514:Dock9 UTSW 14 121,896,199 (GRCm39) missense probably benign 0.25
R8691:Dock9 UTSW 14 121,877,517 (GRCm39) missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121,842,595 (GRCm39) missense probably damaging 0.98
R8894:Dock9 UTSW 14 121,860,373 (GRCm39) missense probably benign 0.10
R8900:Dock9 UTSW 14 121,817,940 (GRCm39) missense probably damaging 1.00
R9069:Dock9 UTSW 14 121,866,324 (GRCm39) missense probably damaging 0.98
R9218:Dock9 UTSW 14 121,905,871 (GRCm39) missense probably damaging 1.00
R9233:Dock9 UTSW 14 121,820,781 (GRCm39) missense probably benign 0.09
R9236:Dock9 UTSW 14 121,876,970 (GRCm39) missense probably damaging 1.00
R9285:Dock9 UTSW 14 121,833,012 (GRCm39) missense probably benign
R9451:Dock9 UTSW 14 121,787,601 (GRCm39) splice site probably benign
R9461:Dock9 UTSW 14 121,842,601 (GRCm39) missense probably benign 0.05
R9484:Dock9 UTSW 14 121,818,844 (GRCm39) missense probably damaging 1.00
R9517:Dock9 UTSW 14 121,829,236 (GRCm39) missense probably benign 0.07
R9542:Dock9 UTSW 14 121,864,775 (GRCm39) missense probably damaging 1.00
R9694:Dock9 UTSW 14 121,818,791 (GRCm39) missense probably damaging 1.00
R9701:Dock9 UTSW 14 121,876,983 (GRCm39) missense probably benign 0.01
R9726:Dock9 UTSW 14 121,835,149 (GRCm39) missense possibly damaging 0.61
R9741:Dock9 UTSW 14 121,877,516 (GRCm39) missense probably damaging 1.00
Z1088:Dock9 UTSW 14 121,792,687 (GRCm39) missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121,889,194 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCTTAATTATTCACACAGTAAGA -3'
(R):5'- GTTATACCTACCTCCTTGATGCT -3'

Sequencing Primer
(F):5'- ACGATTGCTCAAACCCG -3'
(R):5'- TGTTTAGAAAACCTGACAGGAGCTCC -3'
Posted On 2022-10-06