Mutagenetix > Incidental Mutation

Incidental Mutation 'R9703:Btbd9'

729687

Institutional Source

Beutler Lab

Gene Symbol

Btbd9

Ensembl Gene

ENSMUSG00000062202

Gene Name

BTB (POZ) domain containing 9

Synonyms

1700023F20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R9703 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

30215524-30576287 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30530226 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 38 (V38A)

Ref Sequence

ENSEMBL: ENSMUSP00000078845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079924] [ENSMUST00000168787]

AlphaFold

Q8C726

Predicted Effect

possibly damaging
Transcript: ENSMUST00000079924
AA Change: V38A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000078845
Gene: ENSMUSG00000062202
AA Change: V38A

Domain	Start	End	E-Value	Type
BTB	36	137	3.52e-25	SMART
BACK	143	240	1.84e-18	SMART
Pfam:F5_F8_type_C	283	405	3.9e-11	PFAM
Pfam:F5_F8_type_C	431	554	6.3e-12	PFAM
low complexity region	585	612	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168787
AA Change: V38A

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000127300
Gene: ENSMUSG00000062202
AA Change: V38A

Domain	Start	End	E-Value	Type
BTB	36	137	3.52e-25	SMART
BACK	143	240	1.84e-18	SMART
Pfam:F5_F8_type_C	278	405	1.1e-8	PFAM
Pfam:F5_F8_type_C	433	554	1.4e-8	PFAM
low complexity region	585	612	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 98.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a BTB/POZ domain-containing protein. This domain is known to be involved in protein-protein interactions. Polymorphisms at this locus have been reported to be associated with susceptibility to Restless Legs Syndrome and may also be associated with Tourette Syndrome. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele show hyperactivity, unidirectional circling, sleep disturbances, thermal sensory alterations, increased serum iron levels, altered serotonin metabolism, enhanced long-term potentiation and paired-pulse ratios, and enhanced cued and contextual fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600015I10Rik	A	G	6: 48,932,695	T625A	probably benign	Het
Adam20	T	A	8: 40,795,934	N360K	probably damaging	Het
Apob	T	A	12: 7,980,507	L82Q	probably damaging	Het
Arhgap30	T	G	1: 171,407,771	L571R	probably damaging	Het
Atg9a	C	T	1: 75,185,787	C493Y	probably damaging	Het
Brip1	T	C	11: 86,062,004	T984A	possibly damaging	Het
C87977	T	A	4: 144,212,940	D9V	probably damaging	Het
Crocc2	C	A	1: 93,202,722	D908E	probably benign	Het
Crybg3	C	G	16: 59,555,576	A58P	probably damaging	Het
Cts7	T	C	13: 61,356,536	N71S	probably damaging	Het
Ddx46	A	G	13: 55,676,822	Y962C	probably damaging	Het
Dock10	G	A	1: 80,539,823	R1373C	probably damaging	Het
Dock9	A	T	14: 121,544,577	*2043R	probably null	Het
Efs	A	T	14: 54,919,414	V388E	possibly damaging	Het
Esyt1	C	T	10: 128,518,927		probably null	Het
Extl3	G	T	14: 65,054,654	R907S	probably damaging	Het
Fcgbp	G	A	7: 28,106,975	V2123M	probably damaging	Het
Gas2l3	C	T	10: 89,414,081	A392T	probably benign	Het
Golm1	A	T	13: 59,649,619	D137E	probably benign	Het
Grxcr2	T	C	18: 41,991,923	D140G	possibly damaging	Het
Hist2h2aa2	G	A	3: 96,240,241	R4C	probably benign	Het
Hrh1	G	A	6: 114,481,018	C420Y	probably benign	Het
Ints13	A	T	6: 146,557,565	L316Q	probably damaging	Het
Iws1	T	A	18: 32,079,685	D55E	probably damaging	Het
Kcnrg	CACAACAA	CACAA	14: 61,607,560		probably benign	Het
Klrc2	G	C	6: 129,656,444	S215*	probably null	Het
Mpp5	T	A	12: 78,797,076	I18K	probably benign	Het
Muc5b	A	G	7: 141,871,798	T4727A	possibly damaging	Het
Nsd3	T	C	8: 25,641,212	S198P	probably benign	Het
Olfr133	A	T	17: 38,148,965	I126F	possibly damaging	Het
Olfr807	A	T	10: 129,755,417	I11N	possibly damaging	Het
Ovch2	T	A	7: 107,784,570	I523F	probably damaging	Het
Pcdhb1	T	A	18: 37,265,966	D323E	probably damaging	Het
Pfkl	T	A	10: 77,990,308		probably null	Het
Pigc	T	A	1: 161,970,607	F53I	probably benign	Het
Prph2	G	A	17: 46,923,521	A339T	unknown	Het
Prrc2a	T	C	17: 35,159,344	K452E	unknown	Het
Rab36	T	C	10: 75,050,642	W151R	possibly damaging	Het
Sdk1	A	G	5: 142,114,528	T1438A	possibly damaging	Het
Slc25a17	A	T	15: 81,339,992	I55K	probably damaging	Het
Smg1	A	T	7: 118,140,521	I3401N	possibly damaging	Het
Smpd3	T	A	8: 106,265,081	H280L	probably damaging	Het
Srsf10	A	G	4: 135,863,842	H202R	probably benign	Het
Swap70	C	T	7: 110,273,305	R376C	probably damaging	Het
Syde1	G	T	10: 78,585,723	L665M	probably damaging	Het
Tha1	A	G	11: 117,871,037	V126A	probably damaging	Het
Tln2	T	C	9: 67,386,656	H230R	probably damaging	Het
Tnc	G	A	4: 63,971,175	A1698V	probably benign	Het
Twist2	C	A	1: 91,802,022	S132R	probably damaging	Het
Ubr1	C	T	2: 120,901,611	C1170Y	probably damaging	Het
Vwa1	G	A	4: 155,772,879	P154L	probably damaging	Het

Other mutations in Btbd9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01519:Btbd9	APN	17	30299601	missense	possibly damaging	0.71
IGL01651:Btbd9	APN	17	30220417	missense	unknown
IGL01814:Btbd9	APN	17	30299535	missense	probably benign	0.01
IGL01820:Btbd9	APN	17	30527409	missense	possibly damaging	0.82
IGL02014:Btbd9	APN	17	30517150	missense	probably damaging	0.98
IGL02075:Btbd9	APN	17	30274936	nonsense	probably null
IGL02390:Btbd9	APN	17	30524814	missense	probably benign	0.22
IGL02414:Btbd9	APN	17	30220559	missense	possibly damaging	0.95
IGL02748:Btbd9	APN	17	30334297	missense	possibly damaging	0.81
crumbs	UTSW	17	30299736	splice site	probably null
grain	UTSW	17	30274942	missense	possibly damaging	0.92
R0023:Btbd9	UTSW	17	30530214	missense	probably damaging	0.96
R0023:Btbd9	UTSW	17	30530214	missense	probably damaging	0.96
R0122:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0123:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0134:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0189:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0190:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0226:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0268:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0344:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0427:Btbd9	UTSW	17	30274942	missense	possibly damaging	0.92
R0462:Btbd9	UTSW	17	30530217	missense	possibly damaging	0.82
R0645:Btbd9	UTSW	17	30524967	missense	probably damaging	0.96
R0973:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R0973:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R0974:Btbd9	UTSW	17	30299633	missense	probably damaging	0.99
R1061:Btbd9	UTSW	17	30527435	missense	probably benign	0.00
R1763:Btbd9	UTSW	17	30334297	missense	possibly damaging	0.81
R1781:Btbd9	UTSW	17	30513593	missense	probably damaging	1.00
R1902:Btbd9	UTSW	17	30530228	missense	probably damaging	0.98
R1995:Btbd9	UTSW	17	30274930	missense	possibly damaging	0.93
R2224:Btbd9	UTSW	17	30527346	missense	probably damaging	0.98
R2237:Btbd9	UTSW	17	30334328	missense	probably benign
R3684:Btbd9	UTSW	17	30334307	missense	probably damaging	0.99
R3800:Btbd9	UTSW	17	30513659	missense	possibly damaging	0.89
R4403:Btbd9	UTSW	17	30485932	intron	probably benign
R4492:Btbd9	UTSW	17	30527571	missense	probably damaging	0.99
R4654:Btbd9	UTSW	17	30485587	intron	probably benign
R4854:Btbd9	UTSW	17	30524865	missense	probably damaging	0.98
R5710:Btbd9	UTSW	17	30228868	missense	probably benign	0.16
R5963:Btbd9	UTSW	17	30334218	splice site	probably null
R6295:Btbd9	UTSW	17	30299736	splice site	probably null
R6422:Btbd9	UTSW	17	30530256	missense	probably benign
R7023:Btbd9	UTSW	17	30527572	missense	probably benign	0.02
R7826:Btbd9	UTSW	17	30334327	missense	probably benign	0.42
R7922:Btbd9	UTSW	17	30274884	missense	probably benign	0.01
R7962:Btbd9	UTSW	17	30517203	missense	probably damaging	0.99
R8265:Btbd9	UTSW	17	30334304	missense	possibly damaging	0.86
R8786:Btbd9	UTSW	17	30530170	missense	probably damaging	0.97
R9541:Btbd9	UTSW	17	30220464	missense	possibly damaging	0.96
R9591:Btbd9	UTSW	17	30517248	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACACTGGATTCCACTTGG -3'
(R):5'- TCAGTACTGATGGCCTTTGG -3'

Sequencing Primer
(F):5'- GACACTGGATTCCACTTGGTATAC -3'
(R):5'- GTGCGCATGCTCCTCTTG -3'

Posted On

2022-10-06