Incidental Mutation 'R9703:Pcdhb1'
ID 729692
Institutional Source Beutler Lab
Gene Symbol Pcdhb1
Ensembl Gene ENSMUSG00000051663
Gene Name protocadherin beta 1
Synonyms PcdhbA
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.133) question?
Stock # R9703 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 37264938-37267525 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37265966 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 323 (D323E)
Ref Sequence ENSEMBL: ENSMUSP00000057519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052366] [ENSMUST00000115661] [ENSMUST00000194544]
AlphaFold Q91Y08
Predicted Effect probably damaging
Transcript: ENSMUST00000052366
AA Change: D323E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057519
Gene: ENSMUSG00000051663
AA Change: D323E

DomainStartEndE-ValueType
CA 45 131 1.04e-1 SMART
CA 155 240 1.23e-19 SMART
CA 264 345 8.4e-27 SMART
CA 369 450 5.31e-15 SMART
CA 474 560 6.27e-26 SMART
CA 590 671 6.05e-10 SMART
Pfam:Cadherin_C_2 687 772 4.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A G 6: 48,932,695 T625A probably benign Het
Adam20 T A 8: 40,795,934 N360K probably damaging Het
Apob T A 12: 7,980,507 L82Q probably damaging Het
Arhgap30 T G 1: 171,407,771 L571R probably damaging Het
Atg9a C T 1: 75,185,787 C493Y probably damaging Het
Brip1 T C 11: 86,062,004 T984A possibly damaging Het
Btbd9 A G 17: 30,530,226 V38A possibly damaging Het
C87977 T A 4: 144,212,940 D9V probably damaging Het
Crocc2 C A 1: 93,202,722 D908E probably benign Het
Crybg3 C G 16: 59,555,576 A58P probably damaging Het
Cts7 T C 13: 61,356,536 N71S probably damaging Het
Ddx46 A G 13: 55,676,822 Y962C probably damaging Het
Dock10 G A 1: 80,539,823 R1373C probably damaging Het
Dock9 A T 14: 121,544,577 *2043R probably null Het
Efs A T 14: 54,919,414 V388E possibly damaging Het
Esyt1 C T 10: 128,518,927 probably null Het
Extl3 G T 14: 65,054,654 R907S probably damaging Het
Fcgbp G A 7: 28,106,975 V2123M probably damaging Het
Gas2l3 C T 10: 89,414,081 A392T probably benign Het
Golm1 A T 13: 59,649,619 D137E probably benign Het
Grxcr2 T C 18: 41,991,923 D140G possibly damaging Het
Hist2h2aa2 G A 3: 96,240,241 R4C probably benign Het
Hrh1 G A 6: 114,481,018 C420Y probably benign Het
Ints13 A T 6: 146,557,565 L316Q probably damaging Het
Iws1 T A 18: 32,079,685 D55E probably damaging Het
Kcnrg CACAACAA CACAA 14: 61,607,560 probably benign Het
Klrc2 G C 6: 129,656,444 S215* probably null Het
Mpp5 T A 12: 78,797,076 I18K probably benign Het
Muc5b A G 7: 141,871,798 T4727A possibly damaging Het
Nsd3 T C 8: 25,641,212 S198P probably benign Het
Olfr133 A T 17: 38,148,965 I126F possibly damaging Het
Olfr807 A T 10: 129,755,417 I11N possibly damaging Het
Ovch2 T A 7: 107,784,570 I523F probably damaging Het
Pfkl T A 10: 77,990,308 probably null Het
Pigc T A 1: 161,970,607 F53I probably benign Het
Prph2 G A 17: 46,923,521 A339T unknown Het
Prrc2a T C 17: 35,159,344 K452E unknown Het
Rab36 T C 10: 75,050,642 W151R possibly damaging Het
Sdk1 A G 5: 142,114,528 T1438A possibly damaging Het
Slc25a17 A T 15: 81,339,992 I55K probably damaging Het
Smg1 A T 7: 118,140,521 I3401N possibly damaging Het
Smpd3 T A 8: 106,265,081 H280L probably damaging Het
Srsf10 A G 4: 135,863,842 H202R probably benign Het
Swap70 C T 7: 110,273,305 R376C probably damaging Het
Syde1 G T 10: 78,585,723 L665M probably damaging Het
Tha1 A G 11: 117,871,037 V126A probably damaging Het
Tln2 T C 9: 67,386,656 H230R probably damaging Het
Tnc G A 4: 63,971,175 A1698V probably benign Het
Twist2 C A 1: 91,802,022 S132R probably damaging Het
Ubr1 C T 2: 120,901,611 C1170Y probably damaging Het
Vwa1 G A 4: 155,772,879 P154L probably damaging Het
Other mutations in Pcdhb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01547:Pcdhb1 APN 18 37267342 missense probably benign 0.06
IGL01622:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01623:Pcdhb1 APN 18 37266313 missense possibly damaging 0.73
IGL01663:Pcdhb1 APN 18 37267133 missense possibly damaging 0.83
IGL01665:Pcdhb1 APN 18 37267397 missense probably benign 0.01
IGL01780:Pcdhb1 APN 18 37266522 missense probably damaging 1.00
IGL02121:Pcdhb1 APN 18 37265785 missense probably benign 0.06
IGL02468:Pcdhb1 APN 18 37266178 missense probably benign 0.21
IGL02602:Pcdhb1 APN 18 37266796 missense probably damaging 1.00
K3955:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0242:Pcdhb1 UTSW 18 37266735 missense probably benign 0.17
R0329:Pcdhb1 UTSW 18 37267024 missense possibly damaging 0.59
R0627:Pcdhb1 UTSW 18 37265721 missense probably damaging 1.00
R0848:Pcdhb1 UTSW 18 37267422 missense probably benign 0.00
R1187:Pcdhb1 UTSW 18 37265544 missense probably damaging 1.00
R1290:Pcdhb1 UTSW 18 37265230 missense possibly damaging 0.54
R1928:Pcdhb1 UTSW 18 37266180 nonsense probably null
R1957:Pcdhb1 UTSW 18 37265707 missense probably damaging 1.00
R2897:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R2898:Pcdhb1 UTSW 18 37266463 missense probably damaging 1.00
R3037:Pcdhb1 UTSW 18 37265113 missense probably damaging 1.00
R4193:Pcdhb1 UTSW 18 37267146 missense probably damaging 0.99
R4291:Pcdhb1 UTSW 18 37265417 missense probably damaging 1.00
R4308:Pcdhb1 UTSW 18 37266661 missense probably benign 0.00
R4332:Pcdhb1 UTSW 18 37265530 missense probably damaging 1.00
R4606:Pcdhb1 UTSW 18 37265528 nonsense probably null
R4637:Pcdhb1 UTSW 18 37265749 missense possibly damaging 0.95
R5159:Pcdhb1 UTSW 18 37266363 missense possibly damaging 0.89
R5207:Pcdhb1 UTSW 18 37266462 missense probably damaging 1.00
R5211:Pcdhb1 UTSW 18 37266651 missense probably benign 0.06
R5273:Pcdhb1 UTSW 18 37265713 missense probably benign 0.23
R5335:Pcdhb1 UTSW 18 37267255 missense probably benign 0.00
R5398:Pcdhb1 UTSW 18 37266154 missense probably damaging 1.00
R5452:Pcdhb1 UTSW 18 37265758 missense possibly damaging 0.94
R5837:Pcdhb1 UTSW 18 37265827 missense possibly damaging 0.57
R5882:Pcdhb1 UTSW 18 37267177 missense probably benign 0.05
R5947:Pcdhb1 UTSW 18 37266673 missense possibly damaging 0.74
R6109:Pcdhb1 UTSW 18 37265253 missense possibly damaging 0.69
R7052:Pcdhb1 UTSW 18 37266529 missense probably damaging 1.00
R7082:Pcdhb1 UTSW 18 37266991 missense probably damaging 0.99
R7137:Pcdhb1 UTSW 18 37267392 missense possibly damaging 0.69
R7229:Pcdhb1 UTSW 18 37266687 missense probably damaging 1.00
R7392:Pcdhb1 UTSW 18 37265118 missense possibly damaging 0.95
R7993:Pcdhb1 UTSW 18 37266991 missense probably damaging 1.00
R8704:Pcdhb1 UTSW 18 37266349 missense possibly damaging 0.51
R9498:Pcdhb1 UTSW 18 37265463 missense probably damaging 0.99
R9757:Pcdhb1 UTSW 18 37267249 missense probably benign 0.24
T0970:Pcdhb1 UTSW 18 37265973 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGACAATGGCTCTTTGGTGG -3'
(R):5'- GACCAGCGAGTAAGAATTCCGG -3'

Sequencing Primer
(F):5'- TGGTGGTGGTGACTGCC -3'
(R):5'- GAGGAAACAGGTGATTTTTCCTCC -3'
Posted On 2022-10-06