Mutagenetix > Incidental Mutation

Incidental Mutation 'R9705:Aff1'

729744

Institutional Source

Beutler Lab

Gene Symbol

Aff1

Ensembl Gene

ENSMUSG00000029313

Gene Name

AF4/FMR2 family, member 1

Synonyms

9630032B01Rik, Af4, Rob, Mllt2h

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.381) question?

Stock #

R9705 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

103692374-103855322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 103784410 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 298 (L298R)

Ref Sequence

ENSEMBL: ENSMUSP00000059744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000031256
AA Change: L306R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: L306R

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	1223	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000054979
AA Change: L298R

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: L298R

Domain	Start	End	E-Value	Type
Pfam:AF-4	8	1216	N/A	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000153165
AA Change: L306R

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313
AA Change: L306R

Domain	Start	End	E-Value	Type
Pfam:AF-4	16	871	N/A	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A830018L16Rik	C	T	1: 11,518,689	P110L	probably damaging	Het
B4galt1	T	C	4: 40,853,474	K111R	probably benign	Het
Brap	A	G	5: 121,663,310	T87A	probably benign	Het
C1qtnf6	T	A	15: 78,527,293	Q61L	probably benign	Het
Ccar2	C	A	14: 70,142,934	C399F	probably damaging	Het
Cdh15	C	A	8: 122,864,285	D424E	probably damaging	Het
Col4a4	G	A	1: 82,487,592	A954V	unknown	Het
Cul9	T	G	17: 46,543,300	T159P	probably damaging	Het
Cyp3a59	A	G	5: 146,096,310	E164G	probably benign	Het
Dnah11	A	C	12: 118,131,035	L766R	probably damaging	Het
Drd5	T	C	5: 38,320,684	V340A	probably damaging	Het
Ephb6	G	A	6: 41,619,781	E921K	probably benign	Het
Fam83e	G	A	7: 45,722,497	R106K	probably benign	Het
Fsip2	A	G	2: 82,993,290	T6456A	probably benign	Het
H2-M10.6	A	G	17: 36,812,750	N112S	probably benign	Het
Hectd4	A	T	5: 121,310,681	Y364F	probably benign	Het
Hist1h2aa	A	G	13: 23,934,745	N95S	probably benign	Het
Hoxc9	T	A	15: 102,981,930	M93K	possibly damaging	Het
Hsd17b4	A	C	18: 50,191,724	K668T	probably benign	Het
Inpp4b	T	C	8: 82,046,261	V728A	probably benign	Het
Jph3	C	T	8: 121,782,174	R392W	probably damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Mphosph10	T	C	7: 64,377,283	E594G	possibly damaging	Het
Mrm2	G	A	5: 140,331,235	R15W	probably damaging	Het
Neurl4	A	T	11: 69,908,853	D994V	probably damaging	Het
Ngef	G	A	1: 87,503,288	P269L	probably damaging	Het
Odam	T	A	5: 87,889,369	F141I	probably benign	Het
Olfr338	A	G	2: 36,376,950	Y58C	probably damaging	Het
Olfr681	T	A	7: 105,121,634	L59Q	probably damaging	Het
Pck1	T	A	2: 173,158,377	S534T	possibly damaging	Het
Pgm3	A	G	9: 86,555,361	F528L	probably benign	Het
Pi4ka	A	T	16: 17,281,951	I1936N		Het
Ptpn13	T	C	5: 103,533,355	L807S	possibly damaging	Het
Ramp2	T	A	11: 101,246,543	L31Q	possibly damaging	Het
Rars2	A	T	4: 34,646,561	K275N	possibly damaging	Het
Rusc2	A	C	4: 43,424,936	N1131T	probably benign	Het
Snapc1	G	T	12: 73,968,376	K161N	probably damaging	Het
Spag8	G	A	4: 43,652,366	H325Y	possibly damaging	Het
Styk1	CTCTTCATGATTTTCTT	CTCTT	6: 131,301,649		probably benign	Het
Synpo2l	C	T	14: 20,660,921	V773M	probably damaging	Het
Syt3	A	G	7: 44,395,801	D519G	probably damaging	Het
Tacc2	A	G	7: 130,759,288	Y459C	probably damaging	Het
Tmem2	G	A	19: 21,807,424	V424I	probably damaging	Het
Trp53tg5	T	C	2: 164,471,288	S156G	probably benign	Het
Ubb	A	G	11: 62,552,549	Y135C	possibly damaging	Het
Vmn2r90	A	G	17: 17,712,777	I200V	possibly damaging	Het
Zfp27	C	A	7: 29,895,917	V208F	possibly damaging	Het

Other mutations in Aff1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00773:Aff1	APN	5	103784077	missense	probably damaging	1.00
IGL02060:Aff1	APN	5	103783849	missense	possibly damaging	0.51
IGL02081:Aff1	APN	5	103834305	missense	probably damaging	1.00
IGL02108:Aff1	APN	5	103811109	critical splice donor site	probably null
IGL03056:Aff1	APN	5	103811081	missense	probably damaging	0.99
IGL03332:Aff1	APN	5	103841105	nonsense	probably null
IGL03340:Aff1	APN	5	103783804	missense	possibly damaging	0.76
IGL03382:Aff1	APN	5	103841060	missense	possibly damaging	0.86
PIT4495001:Aff1	UTSW	5	103849525	missense	probably benign	0.16
R0013:Aff1	UTSW	5	103828484	nonsense	probably null
R0219:Aff1	UTSW	5	103811040	splice site	probably benign
R0520:Aff1	UTSW	5	103847751	nonsense	probably null
R0607:Aff1	UTSW	5	103828454	missense	probably damaging	1.00
R0883:Aff1	UTSW	5	103826138	splice site	probably benign
R1662:Aff1	UTSW	5	103841057	missense	probably damaging	0.99
R1730:Aff1	UTSW	5	103833512	missense	probably damaging	1.00
R1850:Aff1	UTSW	5	103833907	missense	probably damaging	1.00
R3411:Aff1	UTSW	5	103754706	start codon destroyed	probably null	0.53
R4007:Aff1	UTSW	5	103784222	missense	probably benign	0.15
R4207:Aff1	UTSW	5	103818988	critical splice donor site	probably null
R4702:Aff1	UTSW	5	103811069	missense	probably damaging	1.00
R4730:Aff1	UTSW	5	103843073	missense	possibly damaging	0.95
R4784:Aff1	UTSW	5	103847039	nonsense	probably null
R5166:Aff1	UTSW	5	103754657	start gained	probably benign
R5294:Aff1	UTSW	5	103811157	intron	probably benign
R5435:Aff1	UTSW	5	103754332	unclassified	probably benign
R5436:Aff1	UTSW	5	103783870	missense	probably damaging	1.00
R6065:Aff1	UTSW	5	103842252	missense	probably damaging	1.00
R6114:Aff1	UTSW	5	103842297	missense	probably damaging	0.97
R6298:Aff1	UTSW	5	103754720	missense	possibly damaging	0.68
R7095:Aff1	UTSW	5	103843085	missense	probably damaging	0.97
R7261:Aff1	UTSW	5	103828379	missense	probably damaging	0.97
R7350:Aff1	UTSW	5	103847092	missense	probably benign	0.28
R7423:Aff1	UTSW	5	103847101	missense	probably damaging	1.00
R7469:Aff1	UTSW	5	103833547	missense	probably benign	0.00
R7604:Aff1	UTSW	5	103847809	missense	probably benign	0.09
R7607:Aff1	UTSW	5	103849459	missense	possibly damaging	0.72
R8014:Aff1	UTSW	5	103833869	missense	possibly damaging	0.82
R8219:Aff1	UTSW	5	103846333	missense	probably damaging	1.00
R8315:Aff1	UTSW	5	103811090	missense	probably damaging	0.99
R8837:Aff1	UTSW	5	103834212	missense	possibly damaging	0.77
R8957:Aff1	UTSW	5	103833768	missense	possibly damaging	0.82
R9159:Aff1	UTSW	5	103842265	missense	possibly damaging	0.89
R9377:Aff1	UTSW	5	103833819	missense	probably damaging	0.96
R9381:Aff1	UTSW	5	103833867	missense	possibly damaging	0.85
R9725:Aff1	UTSW	5	103847065	missense	probably damaging	0.99
R9764:Aff1	UTSW	5	103849499	missense	probably damaging	1.00
Z1177:Aff1	UTSW	5	103783753	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- ACGGTTTGGTGGCAGTTACC -3'
(R):5'- GAATTGGGGTTCACAAACTATCAC -3'

Sequencing Primer
(F):5'- TGGCAGTTACCAGCCTTG -3'
(R):5'- TCTGGCCATGCATACACAGGATG -3'

Posted On

2022-10-06