Incidental Mutation 'R9705:H2-M10.6'
ID 729774
Institutional Source Beutler Lab
Gene Symbol H2-M10.6
Ensembl Gene ENSMUSG00000037130
Gene Name histocompatibility 2, M region locus 10.6
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R9705 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 36812171-36815564 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36812750 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 112 (N112S)
Ref Sequence ENSEMBL: ENSMUSP00000039908 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041398]
AlphaFold Q85ZW5
Predicted Effect probably benign
Transcript: ENSMUST00000041398
AA Change: N112S

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000039908
Gene: ENSMUSG00000037130
AA Change: N112S

DomainStartEndE-ValueType
Pfam:MHC_I 24 202 2.2e-47 PFAM
IGc1 221 292 9.31e-22 SMART
transmembrane domain 305 327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C T 1: 11,518,689 P110L probably damaging Het
Aff1 T G 5: 103,784,410 L298R possibly damaging Het
B4galt1 T C 4: 40,853,474 K111R probably benign Het
Brap A G 5: 121,663,310 T87A probably benign Het
C1qtnf6 T A 15: 78,527,293 Q61L probably benign Het
Ccar2 C A 14: 70,142,934 C399F probably damaging Het
Cdh15 C A 8: 122,864,285 D424E probably damaging Het
Col4a4 G A 1: 82,487,592 A954V unknown Het
Cul9 T G 17: 46,543,300 T159P probably damaging Het
Cyp3a59 A G 5: 146,096,310 E164G probably benign Het
Dnah11 A C 12: 118,131,035 L766R probably damaging Het
Drd5 T C 5: 38,320,684 V340A probably damaging Het
Ephb6 G A 6: 41,619,781 E921K probably benign Het
Fam83e G A 7: 45,722,497 R106K probably benign Het
Fsip2 A G 2: 82,993,290 T6456A probably benign Het
Hectd4 A T 5: 121,310,681 Y364F probably benign Het
Hist1h2aa A G 13: 23,934,745 N95S probably benign Het
Hoxc9 T A 15: 102,981,930 M93K possibly damaging Het
Hsd17b4 A C 18: 50,191,724 K668T probably benign Het
Inpp4b T C 8: 82,046,261 V728A probably benign Het
Jph3 C T 8: 121,782,174 R392W probably damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Mphosph10 T C 7: 64,377,283 E594G possibly damaging Het
Mrm2 G A 5: 140,331,235 R15W probably damaging Het
Neurl4 A T 11: 69,908,853 D994V probably damaging Het
Ngef G A 1: 87,503,288 P269L probably damaging Het
Odam T A 5: 87,889,369 F141I probably benign Het
Olfr338 A G 2: 36,376,950 Y58C probably damaging Het
Olfr681 T A 7: 105,121,634 L59Q probably damaging Het
Pck1 T A 2: 173,158,377 S534T possibly damaging Het
Pgm3 A G 9: 86,555,361 F528L probably benign Het
Pi4ka A T 16: 17,281,951 I1936N Het
Ptpn13 T C 5: 103,533,355 L807S possibly damaging Het
Ramp2 T A 11: 101,246,543 L31Q possibly damaging Het
Rars2 A T 4: 34,646,561 K275N possibly damaging Het
Rusc2 A C 4: 43,424,936 N1131T probably benign Het
Snapc1 G T 12: 73,968,376 K161N probably damaging Het
Spag8 G A 4: 43,652,366 H325Y possibly damaging Het
Styk1 CTCTTCATGATTTTCTT CTCTT 6: 131,301,649 probably benign Het
Synpo2l C T 14: 20,660,921 V773M probably damaging Het
Syt3 A G 7: 44,395,801 D519G probably damaging Het
Tacc2 A G 7: 130,759,288 Y459C probably damaging Het
Tmem2 G A 19: 21,807,424 V424I probably damaging Het
Trp53tg5 T C 2: 164,471,288 S156G probably benign Het
Ubb A G 11: 62,552,549 Y135C possibly damaging Het
Vmn2r90 A G 17: 17,712,777 I200V possibly damaging Het
Zfp27 C A 7: 29,895,917 V208F possibly damaging Het
Other mutations in H2-M10.6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:H2-M10.6 APN 17 36812220 missense probably benign 0.13
IGL01590:H2-M10.6 APN 17 36812749 missense probably benign 0.05
IGL03200:H2-M10.6 APN 17 36814016 missense probably damaging 1.00
IGL03278:H2-M10.6 APN 17 36813823 missense probably damaging 0.99
R0018:H2-M10.6 UTSW 17 36814049 missense probably damaging 1.00
R0144:H2-M10.6 UTSW 17 36812241 missense probably damaging 0.99
R0194:H2-M10.6 UTSW 17 36814042 missense probably damaging 1.00
R1168:H2-M10.6 UTSW 17 36813160 missense probably benign
R1757:H2-M10.6 UTSW 17 36813151 missense probably benign 0.00
R1773:H2-M10.6 UTSW 17 36812184 missense probably benign 0.00
R2029:H2-M10.6 UTSW 17 36813907 missense possibly damaging 0.47
R3409:H2-M10.6 UTSW 17 36814001 missense probably damaging 1.00
R3856:H2-M10.6 UTSW 17 36812504 missense probably benign 0.18
R4373:H2-M10.6 UTSW 17 36813066 missense probably damaging 1.00
R4869:H2-M10.6 UTSW 17 36812533 missense probably benign 0.04
R5684:H2-M10.6 UTSW 17 36813854 missense probably damaging 1.00
R6020:H2-M10.6 UTSW 17 36813067 missense probably damaging 1.00
R6180:H2-M10.6 UTSW 17 36814286 missense probably damaging 1.00
R6328:H2-M10.6 UTSW 17 36813944 missense probably damaging 0.96
R8245:H2-M10.6 UTSW 17 36813263 critical splice donor site probably null
R9687:H2-M10.6 UTSW 17 36814255 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTAGACTCCATACAGTTTCAGGG -3'
(R):5'- AGCCTTTGGTCACTATGAGGC -3'

Sequencing Primer
(F):5'- GACTCCATACAGTTTCAGGGATTCG -3'
(R):5'- ATGAGGCTTCTCTTACATCCTAGG -3'
Posted On 2022-10-06