Incidental Mutation 'R9706:Lrriq1'
ID 729813
Institutional Source Beutler Lab
Gene Symbol Lrriq1
Ensembl Gene ENSMUSG00000019892
Gene Name leucine-rich repeats and IQ motif containing 1
Synonyms LOC380658, 4930503E15Rik, Gm1557
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R9706 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 103046031-103236322 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103046041 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 155 (F155S)
Gene Model predicted gene model for transcript(s):
AlphaFold Q0P5X1
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 G A 8: 40,795,453 R200H probably benign Het
Atad3a C T 4: 155,750,472 probably null Het
Atg16l1 T C 1: 87,786,255 F463L possibly damaging Het
Camsap3 C T 8: 3,608,689 T1209I possibly damaging Het
Cldn10 T A 14: 118,861,777 M101K probably damaging Het
Crb2 G A 2: 37,791,203 G686D probably damaging Het
Creb3 T A 4: 43,565,520 L209* probably null Het
Crocc C A 4: 141,018,735 R1855L possibly damaging Het
Decr2 A T 17: 26,083,895 M169K probably benign Het
Defb22 T C 2: 152,485,900 T122A unknown Het
Dnah17 A T 11: 118,126,200 I238N probably damaging Het
Efcab14 T A 4: 115,768,704 S457T possibly damaging Het
Ephb3 A T 16: 21,220,443 I604F probably damaging Het
Fam184a T C 10: 53,699,153 D120G probably damaging Het
Fcrlb T A 1: 170,907,905 T267S possibly damaging Het
Gm15446 A T 5: 109,943,295 Q471L probably damaging Het
H2-Q4 A T 17: 35,380,153 Y133F probably damaging Het
H2-T24 A T 17: 36,014,843 H285Q probably benign Het
Hc A C 2: 35,024,184 V837G probably damaging Het
Hmcn2 G A 2: 31,415,267 V3151I probably benign Het
Inpp5e T A 2: 26,402,114 M311L probably benign Het
Inpp5j A G 11: 3,499,960 F644S possibly damaging Het
Krt79 T G 15: 101,930,761 E424D probably benign Het
Lingo3 A T 10: 80,834,454 F547L probably damaging Het
Lrrc47 T G 4: 154,012,030 L94R probably damaging Het
Masp2 A G 4: 148,612,140 E398G probably benign Het
Mcm3ap C T 10: 76,476,518 S477L probably damaging Het
Mllt10 T C 2: 18,146,844 V256A possibly damaging Het
Muc1 T A 3: 89,231,581 I499K probably benign Het
Nup50 G A 15: 84,927,447 probably null Het
Olfr1019 T A 2: 85,841,314 H159L probably damaging Het
Olfr1181 T A 2: 88,423,435 M197L probably benign Het
Olfr532 A T 7: 140,419,353 I140N probably damaging Het
Olfr670 A G 7: 104,959,988 V248A probably damaging Het
Pclo A T 5: 14,855,669 H4971L unknown Het
Pcsk1 G T 13: 75,099,354 probably null Het
Pih1d3 A C 1: 31,223,171 E78A possibly damaging Het
Pik3r5 C A 11: 68,490,600 T204N probably benign Het
Prrc2b T C 2: 32,217,288 V1621A probably benign Het
Ptchd4 A G 17: 42,503,915 *902W probably null Het
R3hdm2 A G 10: 127,498,429 D907G probably benign Het
R3hdm4 A T 10: 79,916,821 probably null Het
Rbpms2 C T 9: 65,651,003 A107V probably benign Het
Rgs14 G A 13: 55,384,121 E544K probably benign Het
Sacs C T 14: 61,208,373 Q2623* probably null Het
Sec16b G A 1: 157,551,125 probably null Het
Spire1 C T 18: 67,503,438 R386Q probably benign Het
Sqle A T 15: 59,329,776 Y492F probably damaging Het
Stk38l C T 6: 146,775,606 T427I probably benign Het
Tbx5 C A 5: 119,841,844 L152I probably benign Het
Vmn2r101 T C 17: 19,589,663 M237T probably damaging Het
Vmn2r58 A T 7: 41,860,576 F526I probably damaging Het
Vwf G A 6: 125,624,573 R826Q Het
Other mutations in Lrriq1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Lrriq1 APN 10 103161896 missense probably damaging 0.99
IGL01523:Lrriq1 APN 10 103218116 nonsense probably null
IGL01637:Lrriq1 APN 10 103215628 missense probably benign
IGL02019:Lrriq1 APN 10 103178800 missense probably benign 0.02
IGL02153:Lrriq1 APN 10 103170479 missense probably benign 0.01
IGL02341:Lrriq1 APN 10 103224941 missense probably benign 0.03
IGL02343:Lrriq1 APN 10 103234163 splice site probably benign
IGL02408:Lrriq1 APN 10 103146281 missense probably benign 0.17
IGL02431:Lrriq1 APN 10 103200639 missense probably damaging 1.00
IGL02540:Lrriq1 APN 10 103215019 missense probably benign 0.02
IGL02558:Lrriq1 APN 10 103146283 missense probably damaging 1.00
IGL02613:Lrriq1 APN 10 103144548 missense probably damaging 0.99
IGL02642:Lrriq1 APN 10 103221461 critical splice acceptor site probably null
IGL03027:Lrriq1 APN 10 103227196 missense probably benign 0.35
PIT4362001:Lrriq1 UTSW 10 103071194 missense probably benign 0.26
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0050:Lrriq1 UTSW 10 103068931 missense probably damaging 0.99
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0068:Lrriq1 UTSW 10 103063418 missense probably benign 0.02
R0124:Lrriq1 UTSW 10 103170420 critical splice donor site probably null
R0244:Lrriq1 UTSW 10 103215773 missense probably damaging 0.98
R0323:Lrriq1 UTSW 10 103221289 missense possibly damaging 0.91
R0515:Lrriq1 UTSW 10 103068968 splice site probably null
R0522:Lrriq1 UTSW 10 103161777 missense probably damaging 0.99
R0701:Lrriq1 UTSW 10 103234044 missense probably benign
R1220:Lrriq1 UTSW 10 103071129 missense probably benign 0.05
R1261:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1262:Lrriq1 UTSW 10 103234137 missense possibly damaging 0.87
R1451:Lrriq1 UTSW 10 103202515 splice site probably benign
R1642:Lrriq1 UTSW 10 103214456 missense probably benign 0.13
R1643:Lrriq1 UTSW 10 103214824 missense probably benign 0.00
R1647:Lrriq1 UTSW 10 103170648 nonsense probably null
R1830:Lrriq1 UTSW 10 103161759 missense probably benign
R1843:Lrriq1 UTSW 10 103227173 splice site probably null
R2128:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2129:Lrriq1 UTSW 10 103214857 missense probably benign 0.01
R2199:Lrriq1 UTSW 10 103068913 missense probably damaging 1.00
R2354:Lrriq1 UTSW 10 103189987 missense probably damaging 1.00
R2495:Lrriq1 UTSW 10 103202381 missense probably damaging 0.97
R2897:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2898:Lrriq1 UTSW 10 103227250 missense probably damaging 0.99
R2922:Lrriq1 UTSW 10 103214675 missense probably benign 0.00
R2939:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R2965:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R2966:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R3081:Lrriq1 UTSW 10 103144889 missense probably damaging 0.98
R3115:Lrriq1 UTSW 10 103170433 missense probably benign 0.00
R3745:Lrriq1 UTSW 10 103170856 missense probably damaging 0.99
R3813:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3814:Lrriq1 UTSW 10 103216111 missense probably damaging 1.00
R3885:Lrriq1 UTSW 10 103216106 missense probably damaging 0.96
R4378:Lrriq1 UTSW 10 103202364 missense probably damaging 1.00
R4632:Lrriq1 UTSW 10 103221427 missense probably damaging 1.00
R4633:Lrriq1 UTSW 10 103200563 nonsense probably null
R4663:Lrriq1 UTSW 10 103063412 missense possibly damaging 0.88
R4702:Lrriq1 UTSW 10 103215749 missense possibly damaging 0.65
R4793:Lrriq1 UTSW 10 103170466 missense probably benign 0.25
R4801:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4802:Lrriq1 UTSW 10 103221318 missense probably benign 0.02
R4815:Lrriq1 UTSW 10 103144878 missense probably benign 0.10
R4872:Lrriq1 UTSW 10 103178788 missense possibly damaging 0.56
R4877:Lrriq1 UTSW 10 103234038 missense possibly damaging 0.88
R4894:Lrriq1 UTSW 10 103161752 missense possibly damaging 0.86
R4990:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R4991:Lrriq1 UTSW 10 103200559 missense probably damaging 1.00
R5011:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5013:Lrriq1 UTSW 10 103189923 missense probably damaging 1.00
R5122:Lrriq1 UTSW 10 103187453 missense probably damaging 1.00
R5282:Lrriq1 UTSW 10 103215345 missense probably benign 0.01
R5311:Lrriq1 UTSW 10 103214587 missense probably damaging 1.00
R5567:Lrriq1 UTSW 10 103170596 missense possibly damaging 0.56
R5643:Lrriq1 UTSW 10 103215440 missense probably benign 0.00
R5683:Lrriq1 UTSW 10 103173375 missense probably damaging 1.00
R5916:Lrriq1 UTSW 10 103221382 nonsense probably null
R6008:Lrriq1 UTSW 10 103170464 missense probably damaging 1.00
R6022:Lrriq1 UTSW 10 103215534 missense possibly damaging 0.90
R6224:Lrriq1 UTSW 10 103215757 missense probably damaging 1.00
R6254:Lrriq1 UTSW 10 103215451 missense probably benign 0.15
R6311:Lrriq1 UTSW 10 103173393 missense probably benign 0.03
R6460:Lrriq1 UTSW 10 103200698 missense probably damaging 1.00
R6502:Lrriq1 UTSW 10 103227184 missense probably damaging 0.99
R6637:Lrriq1 UTSW 10 103221432 missense probably benign 0.06
R6719:Lrriq1 UTSW 10 103071116 missense probably damaging 1.00
R6736:Lrriq1 UTSW 10 103181889 critical splice acceptor site probably null
R6928:Lrriq1 UTSW 10 103214939 missense possibly damaging 0.95
R6991:Lrriq1 UTSW 10 103187458 missense probably damaging 1.00
R7174:Lrriq1 UTSW 10 103224965 missense probably benign
R7241:Lrriq1 UTSW 10 103215973 missense probably damaging 1.00
R7248:Lrriq1 UTSW 10 103223750 missense possibly damaging 0.85
R7287:Lrriq1 UTSW 10 103216016 missense probably benign 0.00
R7402:Lrriq1 UTSW 10 103221324 missense possibly damaging 0.87
R7439:Lrriq1 UTSW 10 103214519 missense probably benign 0.21
R7585:Lrriq1 UTSW 10 103214946 missense possibly damaging 0.93
R7611:Lrriq1 UTSW 10 103200571 missense possibly damaging 0.54
R7634:Lrriq1 UTSW 10 103200601 missense probably damaging 1.00
R7767:Lrriq1 UTSW 10 103215954 missense probably damaging 0.99
R7809:Lrriq1 UTSW 10 103215817 missense probably damaging 0.99
R7910:Lrriq1 UTSW 10 103215194 nonsense probably null
R8131:Lrriq1 UTSW 10 103215711 missense possibly damaging 0.57
R8156:Lrriq1 UTSW 10 103156335 critical splice donor site probably null
R8211:Lrriq1 UTSW 10 103170547 missense probably damaging 1.00
R8304:Lrriq1 UTSW 10 103234068 missense possibly damaging 0.57
R8487:Lrriq1 UTSW 10 103215053 missense probably damaging 0.98
R8500:Lrriq1 UTSW 10 103046155 missense
R9013:Lrriq1 UTSW 10 103215070 missense probably damaging 1.00
R9099:Lrriq1 UTSW 10 103216003 missense probably damaging 0.98
R9155:Lrriq1 UTSW 10 103214779 missense probably benign 0.03
R9320:Lrriq1 UTSW 10 103221283 missense probably benign
R9384:Lrriq1 UTSW 10 103170597 missense probably benign 0.00
R9469:Lrriq1 UTSW 10 103214900 missense probably benign 0.07
R9585:Lrriq1 UTSW 10 103215389 missense probably benign
R9780:Lrriq1 UTSW 10 103189963 missense probably damaging 1.00
X0026:Lrriq1 UTSW 10 103215704 nonsense probably null
Z1088:Lrriq1 UTSW 10 103202446 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202359 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103202360 missense probably damaging 1.00
Z1176:Lrriq1 UTSW 10 103234085 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCATTTCACAAGAATGCAAGAG -3'
(R):5'- GGTTTAGGACGACCTCTTACTCTAG -3'

Sequencing Primer
(F):5'- TTTCACAAGAATGCAAGAGGAACTGC -3'
(R):5'- GCTCAAGCAAGGGAATCA -3'
Posted On 2022-10-06