Mutagenetix > Incidental Mutation

Incidental Mutation 'R9706:Pcsk1'

729819

Institutional Source

Beutler Lab

Gene Symbol

Pcsk1

Ensembl Gene

ENSMUSG00000021587

Gene Name

proprotein convertase subtilisin/kexin type 1

Synonyms

PC3, PC1, Nec-1, SPC3, prohormone convertase 1/3, Nec1, Phpp-1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R9706 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

75089826-75134861 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to T at 75099354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000022075 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022075]

AlphaFold

P63239

PDB Structure

Solution Structure of the Mouse Prohormone Convertase 1 Pro-Domain [SOLUTION NMR]
PC1/3 DCSG sorting domain structure in DPC [SOLUTION NMR]
PC1/3 DCSG sorting domain in CHAPS [SOLUTION NMR]

Predicted Effect

probably null
Transcript: ENSMUST00000022075

SMART Domains

Protein: ENSMUSP00000022075
Gene: ENSMUSG00000021587

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
Pfam:S8_pro-domain	34	110	6.4e-26	PFAM
Pfam:Peptidase_S8	158	442	2.2e-49	PFAM
Pfam:P_proprotein	504	591	6.1e-30	PFAM
low complexity region	679	694	N/A	INTRINSIC
Pfam:Proho_convert	713	751	4.3e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. The protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Mutations in this gene have been associated with susceptibility to obesity and proprotein convertase 1/3 deficiency. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele show pre- and postnatal death, low weight, diarrhea, hypoglycemia, low insulin and GHRH levels, and lack mature glucagon and ACTH levels. Homozygotes for another null allele die prior to implantation. ENU mutants show obesity, polyphagia and higher metabolic efficiency. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	G	A	8: 40,795,453	R200H	probably benign	Het
Atad3a	C	T	4: 155,750,472		probably null	Het
Atg16l1	T	C	1: 87,786,255	F463L	possibly damaging	Het
Camsap3	C	T	8: 3,608,689	T1209I	possibly damaging	Het
Cldn10	T	A	14: 118,861,777	M101K	probably damaging	Het
Crb2	G	A	2: 37,791,203	G686D	probably damaging	Het
Creb3	T	A	4: 43,565,520	L209*	probably null	Het
Crocc	C	A	4: 141,018,735	R1855L	possibly damaging	Het
Decr2	A	T	17: 26,083,895	M169K	probably benign	Het
Defb22	T	C	2: 152,485,900	T122A	unknown	Het
Dnah17	A	T	11: 118,126,200	I238N	probably damaging	Het
Efcab14	T	A	4: 115,768,704	S457T	possibly damaging	Het
Ephb3	A	T	16: 21,220,443	I604F	probably damaging	Het
Fam184a	T	C	10: 53,699,153	D120G	probably damaging	Het
Fcrlb	T	A	1: 170,907,905	T267S	possibly damaging	Het
Gm15446	A	T	5: 109,943,295	Q471L	probably damaging	Het
H2-Q4	A	T	17: 35,380,153	Y133F	probably damaging	Het
H2-T24	A	T	17: 36,014,843	H285Q	probably benign	Het
Hc	A	C	2: 35,024,184	V837G	probably damaging	Het
Hmcn2	G	A	2: 31,415,267	V3151I	probably benign	Het
Inpp5e	T	A	2: 26,402,114	M311L	probably benign	Het
Inpp5j	A	G	11: 3,499,960	F644S	possibly damaging	Het
Krt79	T	G	15: 101,930,761	E424D	probably benign	Het
Lingo3	A	T	10: 80,834,454	F547L	probably damaging	Het
Lrrc47	T	G	4: 154,012,030	L94R	probably damaging	Het
Lrriq1	A	G	10: 103,046,041	F155S		Het
Masp2	A	G	4: 148,612,140	E398G	probably benign	Het
Mcm3ap	C	T	10: 76,476,518	S477L	probably damaging	Het
Mllt10	T	C	2: 18,146,844	V256A	possibly damaging	Het
Muc1	T	A	3: 89,231,581	I499K	probably benign	Het
Nup50	G	A	15: 84,927,447		probably null	Het
Olfr1019	T	A	2: 85,841,314	H159L	probably damaging	Het
Olfr1181	T	A	2: 88,423,435	M197L	probably benign	Het
Olfr532	A	T	7: 140,419,353	I140N	probably damaging	Het
Olfr670	A	G	7: 104,959,988	V248A	probably damaging	Het
Pclo	A	T	5: 14,855,669	H4971L	unknown	Het
Pih1d3	A	C	1: 31,223,171	E78A	possibly damaging	Het
Pik3r5	C	A	11: 68,490,600	T204N	probably benign	Het
Prrc2b	T	C	2: 32,217,288	V1621A	probably benign	Het
Ptchd4	A	G	17: 42,503,915	*902W	probably null	Het
R3hdm2	A	G	10: 127,498,429	D907G	probably benign	Het
R3hdm4	A	T	10: 79,916,821		probably null	Het
Rbpms2	C	T	9: 65,651,003	A107V	probably benign	Het
Rgs14	G	A	13: 55,384,121	E544K	probably benign	Het
Sacs	C	T	14: 61,208,373	Q2623*	probably null	Het
Sec16b	G	A	1: 157,551,125		probably null	Het
Spire1	C	T	18: 67,503,438	R386Q	probably benign	Het
Sqle	A	T	15: 59,329,776	Y492F	probably damaging	Het
Stk38l	C	T	6: 146,775,606	T427I	probably benign	Het
Tbx5	C	A	5: 119,841,844	L152I	probably benign	Het
Vmn2r101	T	C	17: 19,589,663	M237T	probably damaging	Het
Vmn2r58	A	T	7: 41,860,576	F526I	probably damaging	Het
Vwf	G	A	6: 125,624,573	R826Q		Het

Other mutations in Pcsk1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Pcsk1	APN	13	75132087	missense	probably benign
IGL01554:Pcsk1	APN	13	75132307	missense	probably benign
IGL01960:Pcsk1	APN	13	75093167	missense	possibly damaging	0.82
IGL02026:Pcsk1	APN	13	75112653	missense	probably benign	0.16
IGL02047:Pcsk1	APN	13	75097989	missense	probably benign	0.33
IGL02264:Pcsk1	APN	13	75105959	missense	probably damaging	1.00
IGL02441:Pcsk1	APN	13	75132163	missense	probably benign	0.16
IGL02795:Pcsk1	APN	13	75112620	missense	probably damaging	1.00
IGL02829:Pcsk1	APN	13	75126836	missense	probably damaging	1.00
IGL03116:Pcsk1	APN	13	75132216	missense	probably damaging	0.99
IGL03156:Pcsk1	APN	13	75131951	missense	probably benign
clipper	UTSW	13	75130070	missense	probably damaging	1.00
spareribs	UTSW	13	75115255	missense	possibly damaging	0.88
swivel	UTSW	13	75125984	missense	probably damaging	1.00
Tweeze	UTSW	13	75126839	missense	probably benign	0.00
PIT4453001:Pcsk1	UTSW	13	75112650	missense	probably damaging	1.00
R0771:Pcsk1	UTSW	13	75132162	missense	probably benign	0.31
R0894:Pcsk1	UTSW	13	75097977	missense	probably damaging	1.00
R1014:Pcsk1	UTSW	13	75132234	missense	probably damaging	1.00
R1035:Pcsk1	UTSW	13	75132119	missense	probably benign
R1199:Pcsk1	UTSW	13	75096413	splice site	probably benign
R1517:Pcsk1	UTSW	13	75098047	nonsense	probably null
R1625:Pcsk1	UTSW	13	75126852	missense	probably benign	0.11
R1691:Pcsk1	UTSW	13	75132225	missense	possibly damaging	0.65
R1717:Pcsk1	UTSW	13	75110828	missense	probably damaging	0.99
R2168:Pcsk1	UTSW	13	75112534	intron	probably benign
R2252:Pcsk1	UTSW	13	75126726	missense	probably benign	0.00
R2400:Pcsk1	UTSW	13	75090126	missense	probably benign	0.00
R4110:Pcsk1	UTSW	13	75096369	missense	probably damaging	0.99
R4358:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4359:Pcsk1	UTSW	13	75112719	missense	possibly damaging	0.58
R4657:Pcsk1	UTSW	13	75132235	missense	probably damaging	1.00
R5195:Pcsk1	UTSW	13	75126855	missense	probably damaging	1.00
R5669:Pcsk1	UTSW	13	75130102	missense	probably benign	0.01
R5671:Pcsk1	UTSW	13	75097907	missense	possibly damaging	0.63
R5745:Pcsk1	UTSW	13	75131960	missense	probably benign	0.03
R6107:Pcsk1	UTSW	13	75127848	missense	probably benign	0.09
R6200:Pcsk1	UTSW	13	75115255	missense	possibly damaging	0.88
R6326:Pcsk1	UTSW	13	75132179	missense	possibly damaging	0.89
R6537:Pcsk1	UTSW	13	75132239	missense	probably damaging	1.00
R6541:Pcsk1	UTSW	13	75125984	missense	probably damaging	1.00
R6567:Pcsk1	UTSW	13	75130070	missense	probably damaging	1.00
R6723:Pcsk1	UTSW	13	75093069	splice site	probably null
R7258:Pcsk1	UTSW	13	75093186	missense	probably damaging	1.00
R7357:Pcsk1	UTSW	13	75125960	missense	probably damaging	0.96
R7487:Pcsk1	UTSW	13	75110883	missense	probably benign	0.01
R7519:Pcsk1	UTSW	13	75110865	missense	probably damaging	0.99
R7647:Pcsk1	UTSW	13	75132210	missense	possibly damaging	0.73
R7787:Pcsk1	UTSW	13	75132158	missense	possibly damaging	0.88
R7944:Pcsk1	UTSW	13	75132092	missense	probably benign
R7945:Pcsk1	UTSW	13	75132092	missense	probably benign
R7961:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8009:Pcsk1	UTSW	13	75126839	missense	probably benign	0.00
R8022:Pcsk1	UTSW	13	75099293	missense	possibly damaging	0.77
R8171:Pcsk1	UTSW	13	75090091	nonsense	probably null
R8489:Pcsk1	UTSW	13	75126002	missense	probably damaging	1.00
R9310:Pcsk1	UTSW	13	75090072	missense	probably benign
R9404:Pcsk1	UTSW	13	75132223	missense	probably benign	0.11
R9544:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
R9588:Pcsk1	UTSW	13	75110920	missense	probably damaging	0.99
Z1176:Pcsk1	UTSW	13	75098042	missense	probably damaging	1.00
Z1177:Pcsk1	UTSW	13	75125864	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAAGCTCTAAAGTCCACTCTTTG -3'
(R):5'- CAGTTACACTTTAGGAGCTAAGTTG -3'

Sequencing Primer
(F):5'- ACTCTTTGGAGCTGTCTTTCAGGAAG -3'
(R):5'- ACACTTTAGGAGCTAAGTTGATAATG -3'

Posted On

2022-10-06