Incidental Mutation 'R9709:Scube2'
ID 729974
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703N2430Q5.1, 4932442O19Rik, Cegf1, ICRFP703B1614Q5.1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.510) question?
Stock # R9709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109798676-109865679 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109831764 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 409 (N409K)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: N409K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: N409K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106728
AA Change: N409K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: N409K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: N409K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: N409K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110051M20Rik T C 2: 91,281,754 Q250R probably benign Het
1810062G17Rik T C 3: 36,476,207 S25P unknown Het
4921539E11Rik A G 4: 103,235,481 I268T unknown Het
4930507D05Rik T A 10: 62,449,802 C102S unknown Het
Abca14 T A 7: 120,289,516 Y1228* probably null Het
Abca17 T C 17: 24,298,960 I792V probably benign Het
Abca6 C A 11: 110,211,763 L878F probably benign Het
Adk C A 14: 21,076,318 T4N probably benign Het
Atg2b A T 12: 105,644,881 F1264I probably damaging Het
Atl3 T G 19: 7,530,556 S358A probably benign Het
Atp8a2 T A 14: 60,033,738 Y248F probably damaging Het
Bcas3 T C 11: 85,583,923 V785A probably damaging Het
Cckar C T 5: 53,702,859 probably null Het
Cdc42se2 A G 11: 54,723,591 F47L probably benign Het
Cfap58 T C 19: 47,975,553 L540P probably damaging Het
Copg1 A G 6: 87,891,975 E117G probably benign Het
Cul2 C T 18: 3,431,560 T655M probably damaging Het
Ddi2 T C 4: 141,685,118 Q161R probably benign Het
Dffb T C 4: 153,974,664 Y52C probably damaging Het
Dll1 T C 17: 15,370,936 Q249R probably benign Het
Dnmt3a T A 12: 3,907,701 I894N probably damaging Het
Fam109b C G 15: 82,343,334 A18G probably damaging Het
Fam109b G T 15: 82,343,336 D19Y probably damaging Het
Fshr G A 17: 88,985,837 T471I probably damaging Het
Gabpb1 C T 2: 126,658,568 V4I probably benign Het
Gbp9 T C 5: 105,083,676 Q348R probably damaging Het
Gm14124 T A 2: 150,268,385 C332S possibly damaging Het
Gm21149 G A 5: 15,472,112 S248F unknown Het
Gm21885 G A 11: 94,284,734 S65N probably benign Het
Gpr152 C A 19: 4,142,641 H60Q probably benign Het
Hdac9 A G 12: 34,312,603 S612P probably benign Het
Hhipl2 A G 1: 183,418,816 D102G possibly damaging Het
Hspa9 A G 18: 34,940,241 V530A possibly damaging Het
Igfbp7 T C 5: 77,401,537 N173S unknown Het
Ighv1-75 A G 12: 115,834,171 S44P possibly damaging Het
Iqgap3 C A 3: 88,108,869 F986L probably damaging Het
Itgax G T 7: 128,136,328 G523W probably damaging Het
Itih3 A G 14: 30,915,630 probably null Het
Kcnb2 T C 1: 15,710,299 I465T probably benign Het
Kmt2b A G 7: 30,579,803 V1478A probably damaging Het
Ky A T 9: 102,542,212 I473F probably damaging Het
Lbr A G 1: 181,838,469 V25A probably damaging Het
Ldlr A G 9: 21,745,839 T751A probably benign Het
Lrrtm4 A G 6: 80,809,173 E587G probably damaging Het
Lvrn A C 18: 46,873,780 probably null Het
Mast2 A T 4: 116,315,847 C594S probably damaging Het
Mast4 A G 13: 102,774,203 V644A probably damaging Het
Mcm5 T C 8: 75,115,976 Y293H probably damaging Het
Mthfd2 A T 6: 83,306,683 V339E possibly damaging Het
Muc4 A T 16: 32,770,270 I881F Het
Myo7a A G 7: 98,094,329 S372P possibly damaging Het
Nbea T A 3: 55,786,458 K2180* probably null Het
Neb T C 2: 52,211,495 D4621G probably damaging Het
Nefh C T 11: 4,940,042 S859N probably benign Het
Nek2 T A 1: 191,831,177 H384Q possibly damaging Het
Nfkb2 A G 19: 46,310,343 E645G probably benign Het
Nin G T 12: 70,102,694 P47Q Het
Nit1 C A 1: 171,343,739 K178N probably benign Het
Nrap C A 19: 56,329,020 K1433N probably damaging Het
Nrap T C 19: 56,329,021 K1433R probably benign Het
Nup85 A G 11: 115,566,637 Y55C possibly damaging Het
Olfr237-ps1 G T 6: 43,153,535 V77F possibly damaging Het
Pde1b A G 15: 103,503,558 K29E probably benign Het
Pik3cg A T 12: 32,176,688 Y1067N probably benign Het
Pkd1l1 C T 11: 8,849,016 G2249S probably damaging Het
Plppr4 T A 3: 117,328,327 T201S possibly damaging Het
Polr1e A G 4: 45,018,678 T3A probably benign Het
Pou6f2 G T 13: 18,239,804 Q129K unknown Het
Ppil4 T A 10: 7,799,577 D163E probably benign Het
Pradc1 A G 6: 85,447,970 F82L probably benign Het
Psd3 T C 8: 67,741,762 K784R probably null Het
Ptgs1 C A 2: 36,251,192 S550R probably damaging Het
Pxylp1 A G 9: 96,828,977 L153P probably damaging Het
Rgs10 A C 7: 128,374,005 F146C probably damaging Het
Rimbp2 G A 5: 128,797,811 P239S probably damaging Het
Rp1 A G 1: 4,042,032 Y1199H unknown Het
Rrp12 A T 19: 41,868,792 M1181K probably benign Het
Rundc3b T C 5: 8,520,982 N279S probably benign Het
Sbf2 G T 7: 110,428,307 P494Q probably damaging Het
Scnn1b A G 7: 121,910,470 T281A probably benign Het
Serpina3m A C 12: 104,392,749 D340A probably damaging Het
Sez6 G A 11: 77,974,295 E623K possibly damaging Het
Sgpp2 T C 1: 78,390,563 I111T probably benign Het
Shprh C T 10: 11,162,830 T443I possibly damaging Het
Sis T A 3: 72,891,741 Y1726F possibly damaging Het
Slc17a9 T C 2: 180,732,528 L129P probably damaging Het
Slc1a5 T A 7: 16,793,804 F342I probably benign Het
Slc4a4 T A 5: 89,040,346 probably null Het
Slco3a1 T C 7: 74,303,209 E534G possibly damaging Het
Smok2b A T 17: 13,235,165 I71F possibly damaging Het
Tmbim7 A T 5: 3,661,809 H18L probably damaging Het
Tmem151a A T 19: 5,081,848 Y443* probably null Het
Tnks1bp1 T G 2: 85,071,781 S1674A probably benign Het
Trappc11 T A 8: 47,493,313 I1095F probably damaging Het
Trim11 A G 11: 58,982,038 R183G possibly damaging Het
Trim29 A G 9: 43,320,500 D348G probably benign Het
Ttc28 A T 5: 111,285,771 S2224C probably damaging Het
Vps13d C T 4: 145,149,345 V1537M Het
Zfp184 A G 13: 21,959,495 D457G possibly damaging Het
Znrd1as A T 17: 36,964,357 R7S probably benign Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109808454 missense probably damaging 1.00
IGL01608:Scube2 APN 7 109843254 missense probably benign
IGL02080:Scube2 APN 7 109852478 missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109809180 missense probably benign 0.22
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0020:Scube2 UTSW 7 109830888 splice site probably benign
R0106:Scube2 UTSW 7 109846908 splice site probably benign
R0230:Scube2 UTSW 7 109824764 critical splice donor site probably null
R0255:Scube2 UTSW 7 109824872 missense probably damaging 0.98
R0427:Scube2 UTSW 7 109824837 missense probably benign 0.00
R0612:Scube2 UTSW 7 109804764 splice site probably benign
R0658:Scube2 UTSW 7 109837120 splice site probably benign
R0687:Scube2 UTSW 7 109829128 missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1366:Scube2 UTSW 7 109804614 missense probably damaging 1.00
R1635:Scube2 UTSW 7 109843214 missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109831675 missense probably damaging 1.00
R1972:Scube2 UTSW 7 109809214 missense probably benign 0.16
R2080:Scube2 UTSW 7 109808505 missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109825459 missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109804701 missense probably damaging 1.00
R2325:Scube2 UTSW 7 109843954 missense probably damaging 1.00
R3723:Scube2 UTSW 7 109808406 splice site probably benign
R3887:Scube2 UTSW 7 109843176 splice site probably benign
R3946:Scube2 UTSW 7 109857590 missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109831771 missense probably benign 0.09
R4621:Scube2 UTSW 7 109800650 missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109810713 missense probably damaging 0.96
R4736:Scube2 UTSW 7 109831205 missense probably benign 0.01
R5096:Scube2 UTSW 7 109799244 utr 3 prime probably benign
R5266:Scube2 UTSW 7 109809230 missense probably damaging 1.00
R5579:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R5669:Scube2 UTSW 7 109825439 missense probably benign 0.04
R5838:Scube2 UTSW 7 109808444 missense probably damaging 1.00
R5916:Scube2 UTSW 7 109831724 missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109833013 nonsense probably null
R6731:Scube2 UTSW 7 109810737 missense probably damaging 1.00
R6785:Scube2 UTSW 7 109810617 missense probably benign
R8197:Scube2 UTSW 7 109808477 missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109864170 missense probably benign 0.20
R8273:Scube2 UTSW 7 109809176 missense probably benign 0.00
R8427:Scube2 UTSW 7 109800590 missense probably damaging 1.00
R8882:Scube2 UTSW 7 109852473 missense probably damaging 1.00
R9258:Scube2 UTSW 7 109799308 missense probably damaging 1.00
R9428:Scube2 UTSW 7 109829138 missense probably benign 0.32
R9476:Scube2 UTSW 7 109831762 missense probably damaging 1.00
R9510:Scube2 UTSW 7 109831762 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109838127 missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109843201 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGAGTATGCAAGCACAC -3'
(R):5'- TGGTTAAAACTCTCAACCAAGGC -3'

Sequencing Primer
(F):5'- CAGTCTCAAACCTCCAGATTTGGG -3'
(R):5'- GTTAAAACTCTCAACCAAGGCACATG -3'
Posted On 2022-10-06