Incidental Mutation 'R9709:Scube2'
ID 729974
Institutional Source Beutler Lab
Gene Symbol Scube2
Ensembl Gene ENSMUSG00000007279
Gene Name signal peptide, CUB domain, EGF-like 2
Synonyms ICRFP703B1614Q5.1, Cegf1, ICRFP703N2430Q5.1, 4932442O19Rik
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.527) question?
Stock # R9709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 109397897-109464886 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 109430971 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 409 (N409K)
Ref Sequence ENSEMBL: ENSMUSP00000102340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007423] [ENSMUST00000106728] [ENSMUST00000106729]
AlphaFold Q9JJS0
Predicted Effect probably damaging
Transcript: ENSMUST00000007423
AA Change: N409K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000007423
Gene: ENSMUSG00000007279
AA Change: N409K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 479 490 N/A INTRINSIC
low complexity region 577 594 N/A INTRINSIC
Pfam:GCC2_GCC3 642 692 7.2e-19 PFAM
Pfam:GCC2_GCC3 699 746 2e-16 PFAM
Pfam:GCC2_GCC3 755 802 3.1e-18 PFAM
CUB 807 919 1.23e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106728
AA Change: N409K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102339
Gene: ENSMUSG00000007279
AA Change: N409K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 451 468 N/A INTRINSIC
Pfam:GCC2_GCC3 516 566 6.4e-17 PFAM
Pfam:GCC2_GCC3 573 620 3.5e-14 PFAM
Pfam:GCC2_GCC3 629 676 5.4e-16 PFAM
Blast:CUB 678 727 2e-25 BLAST
Blast:CUB 730 796 1e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000106729
AA Change: N409K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102340
Gene: ENSMUSG00000007279
AA Change: N409K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
EGF_CA 43 83 7.01e-10 SMART
EGF_CA 84 125 1.79e-7 SMART
EGF_CA 126 166 1.5e-9 SMART
EGF 174 212 2.19e-2 SMART
EGF 214 251 4.89e0 SMART
EGF 283 320 5.12e-3 SMART
EGF_CA 321 361 3.7e-9 SMART
EGF_CA 362 400 1.85e-9 SMART
EGF_CA 401 441 2.48e-10 SMART
low complexity region 605 622 N/A INTRINSIC
Pfam:GCC2_GCC3 670 717 1.8e-16 PFAM
Pfam:GCC2_GCC3 726 773 2.7e-18 PFAM
CUB 778 890 1.23e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are smaller than controls. Mice also exhibit defective endochondral bone formation and impaired Ihh-mediated chondrocyte differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,530,356 (GRCm39) S25P unknown Het
4921539E11Rik A G 4: 103,092,678 (GRCm39) I268T unknown Het
4930507D05Rik T A 10: 62,285,581 (GRCm39) C102S unknown Het
Abca14 T A 7: 119,888,739 (GRCm39) Y1228* probably null Het
Abca17 T C 17: 24,517,934 (GRCm39) I792V probably benign Het
Abca6 C A 11: 110,102,589 (GRCm39) L878F probably benign Het
Adk C A 14: 21,126,386 (GRCm39) T4N probably benign Het
Ankrd40cl G A 11: 94,175,560 (GRCm39) S65N probably benign Het
Atg2b A T 12: 105,611,140 (GRCm39) F1264I probably damaging Het
Atl3 T G 19: 7,507,921 (GRCm39) S358A probably benign Het
Atp8a2 T A 14: 60,271,187 (GRCm39) Y248F probably damaging Het
Bcas3 T C 11: 85,474,749 (GRCm39) V785A probably damaging Het
Cckar C T 5: 53,860,201 (GRCm39) probably null Het
Cdc42se2 A G 11: 54,614,417 (GRCm39) F47L probably benign Het
Cfap58 T C 19: 47,963,992 (GRCm39) L540P probably damaging Het
Copg1 A G 6: 87,868,957 (GRCm39) E117G probably benign Het
Cstpp1 T C 2: 91,112,099 (GRCm39) Q250R probably benign Het
Cul2 C T 18: 3,431,560 (GRCm39) T655M probably damaging Het
Ddi2 T C 4: 141,412,429 (GRCm39) Q161R probably benign Het
Dffb T C 4: 154,059,121 (GRCm39) Y52C probably damaging Het
Dll1 T C 17: 15,591,198 (GRCm39) Q249R probably benign Het
Dnmt3a T A 12: 3,957,701 (GRCm39) I894N probably damaging Het
Fshr G A 17: 89,293,265 (GRCm39) T471I probably damaging Het
Gabpb1 C T 2: 126,500,488 (GRCm39) V4I probably benign Het
Gbp9 T C 5: 105,231,542 (GRCm39) Q348R probably damaging Het
Gm21149 G A 5: 15,677,110 (GRCm39) S248F unknown Het
Gpr152 C A 19: 4,192,640 (GRCm39) H60Q probably benign Het
Hdac9 A G 12: 34,362,602 (GRCm39) S612P probably benign Het
Hhipl2 A G 1: 183,199,747 (GRCm39) D102G possibly damaging Het
Hspa9 A G 18: 35,073,294 (GRCm39) V530A possibly damaging Het
Igfbp7 T C 5: 77,549,384 (GRCm39) N173S unknown Het
Ighv1-75 A G 12: 115,797,791 (GRCm39) S44P possibly damaging Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Itgax G T 7: 127,735,500 (GRCm39) G523W probably damaging Het
Itih3 A G 14: 30,637,587 (GRCm39) probably null Het
Kcnb2 T C 1: 15,780,523 (GRCm39) I465T probably benign Het
Kmt2b A G 7: 30,279,228 (GRCm39) V1478A probably damaging Het
Ky A T 9: 102,419,411 (GRCm39) I473F probably damaging Het
Lbr A G 1: 181,666,034 (GRCm39) V25A probably damaging Het
Ldlr A G 9: 21,657,135 (GRCm39) T751A probably benign Het
Lrrtm4 A G 6: 80,786,154 (GRCm39) E587G probably damaging Het
Lvrn A C 18: 47,006,847 (GRCm39) probably null Het
Mast2 A T 4: 116,173,044 (GRCm39) C594S probably damaging Het
Mast4 A G 13: 102,910,711 (GRCm39) V644A probably damaging Het
Mcm5 T C 8: 75,842,604 (GRCm39) Y293H probably damaging Het
Mthfd2 A T 6: 83,283,665 (GRCm39) V339E possibly damaging Het
Muc4 A T 16: 32,590,644 (GRCm39) I881F Het
Myo7a A G 7: 97,743,536 (GRCm39) S372P possibly damaging Het
Nbea T A 3: 55,693,879 (GRCm39) K2180* probably null Het
Neb T C 2: 52,101,507 (GRCm39) D4621G probably damaging Het
Nefh C T 11: 4,890,042 (GRCm39) S859N probably benign Het
Nek2 T A 1: 191,563,289 (GRCm39) H384Q possibly damaging Het
Nfkb2 A G 19: 46,298,782 (GRCm39) E645G probably benign Het
Nin G T 12: 70,149,468 (GRCm39) P47Q Het
Nit1 C A 1: 171,171,307 (GRCm39) K178N probably benign Het
Nrap C A 19: 56,317,452 (GRCm39) K1433N probably damaging Het
Nrap T C 19: 56,317,453 (GRCm39) K1433R probably benign Het
Nup85 A G 11: 115,457,463 (GRCm39) Y55C possibly damaging Het
Or2a14 G T 6: 43,130,469 (GRCm39) V77F possibly damaging Het
Pde1b A G 15: 103,411,985 (GRCm39) K29E probably benign Het
Pheta2 G T 15: 82,227,537 (GRCm39) D19Y probably damaging Het
Pheta2 C G 15: 82,227,535 (GRCm39) A18G probably damaging Het
Pik3cg A T 12: 32,226,687 (GRCm39) Y1067N probably benign Het
Pkd1l1 C T 11: 8,799,016 (GRCm39) G2249S probably damaging Het
Plppr4 T A 3: 117,121,976 (GRCm39) T201S possibly damaging Het
Polr1e A G 4: 45,018,678 (GRCm39) T3A probably benign Het
Polr1has A T 17: 37,275,249 (GRCm39) R7S probably benign Het
Pou6f2 G T 13: 18,414,389 (GRCm39) Q129K unknown Het
Ppil4 T A 10: 7,675,341 (GRCm39) D163E probably benign Het
Pradc1 A G 6: 85,424,952 (GRCm39) F82L probably benign Het
Psd3 T C 8: 68,194,414 (GRCm39) K784R probably null Het
Ptgs1 C A 2: 36,141,204 (GRCm39) S550R probably damaging Het
Pxylp1 A G 9: 96,711,030 (GRCm39) L153P probably damaging Het
Rgs10 A C 7: 127,975,729 (GRCm39) F146C probably damaging Het
Rimbp2 G A 5: 128,874,875 (GRCm39) P239S probably damaging Het
Rp1 A G 1: 4,112,255 (GRCm39) Y1199H unknown Het
Rrp12 A T 19: 41,857,231 (GRCm39) M1181K probably benign Het
Rundc3b T C 5: 8,570,982 (GRCm39) N279S probably benign Het
Sbf2 G T 7: 110,027,514 (GRCm39) P494Q probably damaging Het
Scnn1b A G 7: 121,509,693 (GRCm39) T281A probably benign Het
Serpina3m A C 12: 104,359,008 (GRCm39) D340A probably damaging Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sgpp2 T C 1: 78,367,200 (GRCm39) I111T probably benign Het
Shprh C T 10: 11,038,574 (GRCm39) T443I possibly damaging Het
Sis T A 3: 72,799,074 (GRCm39) Y1726F possibly damaging Het
Slc17a9 T C 2: 180,374,321 (GRCm39) L129P probably damaging Het
Slc1a5 T A 7: 16,527,729 (GRCm39) F342I probably benign Het
Slc4a4 T A 5: 89,188,205 (GRCm39) probably null Het
Slco3a1 T C 7: 73,952,957 (GRCm39) E534G possibly damaging Het
Smok2b A T 17: 13,454,052 (GRCm39) I71F possibly damaging Het
Tmbim7 A T 5: 3,711,809 (GRCm39) H18L probably damaging Het
Tmem151a A T 19: 5,131,876 (GRCm39) Y443* probably null Het
Tnks1bp1 T G 2: 84,902,125 (GRCm39) S1674A probably benign Het
Trappc11 T A 8: 47,946,348 (GRCm39) I1095F probably damaging Het
Trim11 A G 11: 58,872,864 (GRCm39) R183G possibly damaging Het
Trim29 A G 9: 43,231,797 (GRCm39) D348G probably benign Het
Ttc28 A T 5: 111,433,637 (GRCm39) S2224C probably damaging Het
Vps13d C T 4: 144,875,915 (GRCm39) V1537M Het
Zfp1005 T A 2: 150,110,305 (GRCm39) C332S possibly damaging Het
Zfp184 A G 13: 22,143,665 (GRCm39) D457G possibly damaging Het
Other mutations in Scube2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Scube2 APN 7 109,407,661 (GRCm39) missense probably damaging 1.00
IGL01608:Scube2 APN 7 109,442,461 (GRCm39) missense probably benign
IGL02080:Scube2 APN 7 109,451,685 (GRCm39) missense probably damaging 1.00
PIT4445001:Scube2 UTSW 7 109,408,387 (GRCm39) missense probably benign 0.22
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0020:Scube2 UTSW 7 109,430,095 (GRCm39) splice site probably benign
R0106:Scube2 UTSW 7 109,446,115 (GRCm39) splice site probably benign
R0230:Scube2 UTSW 7 109,423,971 (GRCm39) critical splice donor site probably null
R0255:Scube2 UTSW 7 109,424,079 (GRCm39) missense probably damaging 0.98
R0427:Scube2 UTSW 7 109,424,044 (GRCm39) missense probably benign 0.00
R0612:Scube2 UTSW 7 109,403,971 (GRCm39) splice site probably benign
R0658:Scube2 UTSW 7 109,436,327 (GRCm39) splice site probably benign
R0687:Scube2 UTSW 7 109,428,335 (GRCm39) missense possibly damaging 0.47
R1087:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1366:Scube2 UTSW 7 109,403,821 (GRCm39) missense probably damaging 1.00
R1635:Scube2 UTSW 7 109,442,421 (GRCm39) missense possibly damaging 0.90
R1797:Scube2 UTSW 7 109,430,882 (GRCm39) missense probably damaging 1.00
R1972:Scube2 UTSW 7 109,408,421 (GRCm39) missense probably benign 0.16
R2080:Scube2 UTSW 7 109,407,712 (GRCm39) missense possibly damaging 0.77
R2254:Scube2 UTSW 7 109,424,666 (GRCm39) missense possibly damaging 0.47
R2315:Scube2 UTSW 7 109,403,908 (GRCm39) missense probably damaging 1.00
R2325:Scube2 UTSW 7 109,443,161 (GRCm39) missense probably damaging 1.00
R3723:Scube2 UTSW 7 109,407,613 (GRCm39) splice site probably benign
R3887:Scube2 UTSW 7 109,442,383 (GRCm39) splice site probably benign
R3946:Scube2 UTSW 7 109,456,797 (GRCm39) missense possibly damaging 0.81
R4030:Scube2 UTSW 7 109,430,978 (GRCm39) missense probably benign 0.09
R4621:Scube2 UTSW 7 109,399,857 (GRCm39) missense possibly damaging 0.63
R4684:Scube2 UTSW 7 109,409,920 (GRCm39) missense probably damaging 0.96
R4736:Scube2 UTSW 7 109,430,412 (GRCm39) missense probably benign 0.01
R5096:Scube2 UTSW 7 109,398,451 (GRCm39) utr 3 prime probably benign
R5266:Scube2 UTSW 7 109,408,437 (GRCm39) missense probably damaging 1.00
R5579:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R5669:Scube2 UTSW 7 109,424,646 (GRCm39) missense probably benign 0.04
R5838:Scube2 UTSW 7 109,407,651 (GRCm39) missense probably damaging 1.00
R5916:Scube2 UTSW 7 109,430,931 (GRCm39) missense possibly damaging 0.77
R6056:Scube2 UTSW 7 109,432,220 (GRCm39) nonsense probably null
R6731:Scube2 UTSW 7 109,409,944 (GRCm39) missense probably damaging 1.00
R6785:Scube2 UTSW 7 109,409,824 (GRCm39) missense probably benign
R8197:Scube2 UTSW 7 109,407,684 (GRCm39) missense possibly damaging 0.53
R8250:Scube2 UTSW 7 109,463,377 (GRCm39) missense probably benign 0.20
R8273:Scube2 UTSW 7 109,408,383 (GRCm39) missense probably benign 0.00
R8427:Scube2 UTSW 7 109,399,797 (GRCm39) missense probably damaging 1.00
R8882:Scube2 UTSW 7 109,451,680 (GRCm39) missense probably damaging 1.00
R9258:Scube2 UTSW 7 109,398,515 (GRCm39) missense probably damaging 1.00
R9428:Scube2 UTSW 7 109,428,345 (GRCm39) missense probably benign 0.32
R9476:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
R9510:Scube2 UTSW 7 109,430,969 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,442,408 (GRCm39) missense probably damaging 1.00
Z1177:Scube2 UTSW 7 109,437,334 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTGGAGTATGCAAGCACAC -3'
(R):5'- TGGTTAAAACTCTCAACCAAGGC -3'

Sequencing Primer
(F):5'- CAGTCTCAAACCTCCAGATTTGGG -3'
(R):5'- GTTAAAACTCTCAACCAAGGCACATG -3'
Posted On 2022-10-06