Incidental Mutation 'R9709:Ldlr'
ID 729983
Institutional Source Beutler Lab
Gene Symbol Ldlr
Ensembl Gene ENSMUSG00000032193
Gene Name low density lipoprotein receptor
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9709 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 21634872-21661215 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 21657135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 751 (T751A)
Ref Sequence ENSEMBL: ENSMUSP00000034713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034713] [ENSMUST00000213114]
AlphaFold P35951
Predicted Effect probably benign
Transcript: ENSMUST00000034713
AA Change: T751A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000034713
Gene: ENSMUSG00000032193
AA Change: T751A

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
LDLa 26 65 1.89e-14 SMART
LDLa 67 106 9.81e-13 SMART
EGF_like 108 144 6.81e1 SMART
LDLa 108 145 3.77e-14 SMART
LDLa 147 186 6.67e-15 SMART
LDLa 197 234 1.16e-14 SMART
LDLa 236 273 3.24e-13 SMART
LDLa 276 316 1e-9 SMART
EGF 318 354 3.2e-4 SMART
EGF_CA 355 394 4.09e-11 SMART
LY 420 462 1.11e-3 SMART
LY 466 508 4.7e-11 SMART
LY 509 552 5.23e-9 SMART
LY 553 595 7.86e-13 SMART
LY 596 639 3.25e-5 SMART
EGF 666 713 7.64e-2 SMART
low complexity region 799 811 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213114
AA Change: T699A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. Mutations in this gene cause the autosomal dominant disorder, familial hypercholesterolemia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous targeted mutants exhibit 2X higher total plasma cholesterol and 7-9X higher IDL and LDL levels on a normal diet compared to controls. On a high cholesterol diet, mutant effects dramatically increase and mice develop xanthomatosis and atherosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,530,356 (GRCm39) S25P unknown Het
4921539E11Rik A G 4: 103,092,678 (GRCm39) I268T unknown Het
4930507D05Rik T A 10: 62,285,581 (GRCm39) C102S unknown Het
Abca14 T A 7: 119,888,739 (GRCm39) Y1228* probably null Het
Abca17 T C 17: 24,517,934 (GRCm39) I792V probably benign Het
Abca6 C A 11: 110,102,589 (GRCm39) L878F probably benign Het
Adk C A 14: 21,126,386 (GRCm39) T4N probably benign Het
Ankrd40cl G A 11: 94,175,560 (GRCm39) S65N probably benign Het
Atg2b A T 12: 105,611,140 (GRCm39) F1264I probably damaging Het
Atl3 T G 19: 7,507,921 (GRCm39) S358A probably benign Het
Atp8a2 T A 14: 60,271,187 (GRCm39) Y248F probably damaging Het
Bcas3 T C 11: 85,474,749 (GRCm39) V785A probably damaging Het
Cckar C T 5: 53,860,201 (GRCm39) probably null Het
Cdc42se2 A G 11: 54,614,417 (GRCm39) F47L probably benign Het
Cfap58 T C 19: 47,963,992 (GRCm39) L540P probably damaging Het
Copg1 A G 6: 87,868,957 (GRCm39) E117G probably benign Het
Cstpp1 T C 2: 91,112,099 (GRCm39) Q250R probably benign Het
Cul2 C T 18: 3,431,560 (GRCm39) T655M probably damaging Het
Ddi2 T C 4: 141,412,429 (GRCm39) Q161R probably benign Het
Dffb T C 4: 154,059,121 (GRCm39) Y52C probably damaging Het
Dll1 T C 17: 15,591,198 (GRCm39) Q249R probably benign Het
Dnmt3a T A 12: 3,957,701 (GRCm39) I894N probably damaging Het
Fshr G A 17: 89,293,265 (GRCm39) T471I probably damaging Het
Gabpb1 C T 2: 126,500,488 (GRCm39) V4I probably benign Het
Gbp9 T C 5: 105,231,542 (GRCm39) Q348R probably damaging Het
Gm21149 G A 5: 15,677,110 (GRCm39) S248F unknown Het
Gpr152 C A 19: 4,192,640 (GRCm39) H60Q probably benign Het
Hdac9 A G 12: 34,362,602 (GRCm39) S612P probably benign Het
Hhipl2 A G 1: 183,199,747 (GRCm39) D102G possibly damaging Het
Hspa9 A G 18: 35,073,294 (GRCm39) V530A possibly damaging Het
Igfbp7 T C 5: 77,549,384 (GRCm39) N173S unknown Het
Ighv1-75 A G 12: 115,797,791 (GRCm39) S44P possibly damaging Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Itgax G T 7: 127,735,500 (GRCm39) G523W probably damaging Het
Itih3 A G 14: 30,637,587 (GRCm39) probably null Het
Kcnb2 T C 1: 15,780,523 (GRCm39) I465T probably benign Het
Kmt2b A G 7: 30,279,228 (GRCm39) V1478A probably damaging Het
Ky A T 9: 102,419,411 (GRCm39) I473F probably damaging Het
Lbr A G 1: 181,666,034 (GRCm39) V25A probably damaging Het
Lrrtm4 A G 6: 80,786,154 (GRCm39) E587G probably damaging Het
Lvrn A C 18: 47,006,847 (GRCm39) probably null Het
Mast2 A T 4: 116,173,044 (GRCm39) C594S probably damaging Het
Mast4 A G 13: 102,910,711 (GRCm39) V644A probably damaging Het
Mcm5 T C 8: 75,842,604 (GRCm39) Y293H probably damaging Het
Mthfd2 A T 6: 83,283,665 (GRCm39) V339E possibly damaging Het
Muc4 A T 16: 32,590,644 (GRCm39) I881F Het
Myo7a A G 7: 97,743,536 (GRCm39) S372P possibly damaging Het
Nbea T A 3: 55,693,879 (GRCm39) K2180* probably null Het
Neb T C 2: 52,101,507 (GRCm39) D4621G probably damaging Het
Nefh C T 11: 4,890,042 (GRCm39) S859N probably benign Het
Nek2 T A 1: 191,563,289 (GRCm39) H384Q possibly damaging Het
Nfkb2 A G 19: 46,298,782 (GRCm39) E645G probably benign Het
Nin G T 12: 70,149,468 (GRCm39) P47Q Het
Nit1 C A 1: 171,171,307 (GRCm39) K178N probably benign Het
Nrap C A 19: 56,317,452 (GRCm39) K1433N probably damaging Het
Nrap T C 19: 56,317,453 (GRCm39) K1433R probably benign Het
Nup85 A G 11: 115,457,463 (GRCm39) Y55C possibly damaging Het
Or2a14 G T 6: 43,130,469 (GRCm39) V77F possibly damaging Het
Pde1b A G 15: 103,411,985 (GRCm39) K29E probably benign Het
Pheta2 G T 15: 82,227,537 (GRCm39) D19Y probably damaging Het
Pheta2 C G 15: 82,227,535 (GRCm39) A18G probably damaging Het
Pik3cg A T 12: 32,226,687 (GRCm39) Y1067N probably benign Het
Pkd1l1 C T 11: 8,799,016 (GRCm39) G2249S probably damaging Het
Plppr4 T A 3: 117,121,976 (GRCm39) T201S possibly damaging Het
Polr1e A G 4: 45,018,678 (GRCm39) T3A probably benign Het
Polr1has A T 17: 37,275,249 (GRCm39) R7S probably benign Het
Pou6f2 G T 13: 18,414,389 (GRCm39) Q129K unknown Het
Ppil4 T A 10: 7,675,341 (GRCm39) D163E probably benign Het
Pradc1 A G 6: 85,424,952 (GRCm39) F82L probably benign Het
Psd3 T C 8: 68,194,414 (GRCm39) K784R probably null Het
Ptgs1 C A 2: 36,141,204 (GRCm39) S550R probably damaging Het
Pxylp1 A G 9: 96,711,030 (GRCm39) L153P probably damaging Het
Rgs10 A C 7: 127,975,729 (GRCm39) F146C probably damaging Het
Rimbp2 G A 5: 128,874,875 (GRCm39) P239S probably damaging Het
Rp1 A G 1: 4,112,255 (GRCm39) Y1199H unknown Het
Rrp12 A T 19: 41,857,231 (GRCm39) M1181K probably benign Het
Rundc3b T C 5: 8,570,982 (GRCm39) N279S probably benign Het
Sbf2 G T 7: 110,027,514 (GRCm39) P494Q probably damaging Het
Scnn1b A G 7: 121,509,693 (GRCm39) T281A probably benign Het
Scube2 A T 7: 109,430,971 (GRCm39) N409K probably damaging Het
Serpina3m A C 12: 104,359,008 (GRCm39) D340A probably damaging Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sgpp2 T C 1: 78,367,200 (GRCm39) I111T probably benign Het
Shprh C T 10: 11,038,574 (GRCm39) T443I possibly damaging Het
Sis T A 3: 72,799,074 (GRCm39) Y1726F possibly damaging Het
Slc17a9 T C 2: 180,374,321 (GRCm39) L129P probably damaging Het
Slc1a5 T A 7: 16,527,729 (GRCm39) F342I probably benign Het
Slc4a4 T A 5: 89,188,205 (GRCm39) probably null Het
Slco3a1 T C 7: 73,952,957 (GRCm39) E534G possibly damaging Het
Smok2b A T 17: 13,454,052 (GRCm39) I71F possibly damaging Het
Tmbim7 A T 5: 3,711,809 (GRCm39) H18L probably damaging Het
Tmem151a A T 19: 5,131,876 (GRCm39) Y443* probably null Het
Tnks1bp1 T G 2: 84,902,125 (GRCm39) S1674A probably benign Het
Trappc11 T A 8: 47,946,348 (GRCm39) I1095F probably damaging Het
Trim11 A G 11: 58,872,864 (GRCm39) R183G possibly damaging Het
Trim29 A G 9: 43,231,797 (GRCm39) D348G probably benign Het
Ttc28 A T 5: 111,433,637 (GRCm39) S2224C probably damaging Het
Vps13d C T 4: 144,875,915 (GRCm39) V1537M Het
Zfp1005 T A 2: 150,110,305 (GRCm39) C332S possibly damaging Het
Zfp184 A G 13: 22,143,665 (GRCm39) D457G possibly damaging Het
Other mutations in Ldlr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Ldlr APN 9 21,646,657 (GRCm39) critical splice donor site probably null
IGL01975:Ldlr APN 9 21,644,993 (GRCm39) missense probably benign 0.05
IGL02043:Ldlr APN 9 21,644,795 (GRCm39) missense probably benign 0.03
IGL02524:Ldlr APN 9 21,644,977 (GRCm39) missense probably damaging 1.00
IGL03049:Ldlr APN 9 21,657,115 (GRCm39) missense probably benign 0.00
IGL03113:Ldlr APN 9 21,651,124 (GRCm39) missense possibly damaging 0.85
R0240:Ldlr UTSW 9 21,649,295 (GRCm39) splice site probably benign
R0586:Ldlr UTSW 9 21,651,040 (GRCm39) missense probably benign 0.00
R1398:Ldlr UTSW 9 21,650,838 (GRCm39) missense probably benign 0.01
R1587:Ldlr UTSW 9 21,649,209 (GRCm39) missense probably damaging 0.99
R2198:Ldlr UTSW 9 21,643,698 (GRCm39) missense probably damaging 1.00
R3730:Ldlr UTSW 9 21,643,097 (GRCm39) missense probably benign 0.09
R4422:Ldlr UTSW 9 21,649,248 (GRCm39) missense probably damaging 1.00
R5044:Ldlr UTSW 9 21,646,538 (GRCm39) missense probably benign 0.00
R5046:Ldlr UTSW 9 21,657,203 (GRCm39) critical splice donor site probably null
R6186:Ldlr UTSW 9 21,635,055 (GRCm39) start gained probably benign
R6195:Ldlr UTSW 9 21,643,077 (GRCm39) nonsense probably null
R6523:Ldlr UTSW 9 21,648,549 (GRCm39) missense probably damaging 1.00
R6682:Ldlr UTSW 9 21,643,671 (GRCm39) missense probably benign
R7256:Ldlr UTSW 9 21,657,040 (GRCm39) missense probably benign 0.01
R7384:Ldlr UTSW 9 21,651,090 (GRCm39) missense probably benign 0.07
R7823:Ldlr UTSW 9 21,653,602 (GRCm39) critical splice donor site probably null
R8065:Ldlr UTSW 9 21,649,241 (GRCm39) missense probably damaging 1.00
R8223:Ldlr UTSW 9 21,658,546 (GRCm39) missense probably damaging 1.00
R8732:Ldlr UTSW 9 21,650,985 (GRCm39) missense probably benign 0.00
R8931:Ldlr UTSW 9 21,643,108 (GRCm39) missense probably damaging 0.99
R8954:Ldlr UTSW 9 21,650,828 (GRCm39) missense possibly damaging 0.87
R9315:Ldlr UTSW 9 21,644,782 (GRCm39) splice site probably benign
R9489:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
R9517:Ldlr UTSW 9 21,655,240 (GRCm39) missense possibly damaging 0.90
R9605:Ldlr UTSW 9 21,646,626 (GRCm39) missense probably damaging 1.00
X0024:Ldlr UTSW 9 21,651,114 (GRCm39) missense probably damaging 1.00
Z1177:Ldlr UTSW 9 21,651,126 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGGAATTTGGTGGCCTGC -3'
(R):5'- ACATTTGCACAGAAACTGTACC -3'

Sequencing Primer
(F):5'- CGTTCCACCCAGAGCAGAG -3'
(R):5'- TGCCAAGCTTGCTAACCTGAG -3'
Posted On 2022-10-06