Incidental Mutation 'R9709:Shprh'
ID 729988
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R9709 (G1)
Quality Score 213.009
Status Not validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11038574 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 443 (T443I)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]
AlphaFold Q7TPQ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000044053
AA Change: T443I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: T443I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000054814
AA Change: T443I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: T443I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: T443I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: T443I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000159810
AA Change: T443I

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: T443I

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160461
SMART Domains Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
PHD 131 178 2.33e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,530,356 (GRCm39) S25P unknown Het
4921539E11Rik A G 4: 103,092,678 (GRCm39) I268T unknown Het
4930507D05Rik T A 10: 62,285,581 (GRCm39) C102S unknown Het
Abca14 T A 7: 119,888,739 (GRCm39) Y1228* probably null Het
Abca17 T C 17: 24,517,934 (GRCm39) I792V probably benign Het
Abca6 C A 11: 110,102,589 (GRCm39) L878F probably benign Het
Adk C A 14: 21,126,386 (GRCm39) T4N probably benign Het
Ankrd40cl G A 11: 94,175,560 (GRCm39) S65N probably benign Het
Atg2b A T 12: 105,611,140 (GRCm39) F1264I probably damaging Het
Atl3 T G 19: 7,507,921 (GRCm39) S358A probably benign Het
Atp8a2 T A 14: 60,271,187 (GRCm39) Y248F probably damaging Het
Bcas3 T C 11: 85,474,749 (GRCm39) V785A probably damaging Het
Cckar C T 5: 53,860,201 (GRCm39) probably null Het
Cdc42se2 A G 11: 54,614,417 (GRCm39) F47L probably benign Het
Cfap58 T C 19: 47,963,992 (GRCm39) L540P probably damaging Het
Copg1 A G 6: 87,868,957 (GRCm39) E117G probably benign Het
Cstpp1 T C 2: 91,112,099 (GRCm39) Q250R probably benign Het
Cul2 C T 18: 3,431,560 (GRCm39) T655M probably damaging Het
Ddi2 T C 4: 141,412,429 (GRCm39) Q161R probably benign Het
Dffb T C 4: 154,059,121 (GRCm39) Y52C probably damaging Het
Dll1 T C 17: 15,591,198 (GRCm39) Q249R probably benign Het
Dnmt3a T A 12: 3,957,701 (GRCm39) I894N probably damaging Het
Fshr G A 17: 89,293,265 (GRCm39) T471I probably damaging Het
Gabpb1 C T 2: 126,500,488 (GRCm39) V4I probably benign Het
Gbp9 T C 5: 105,231,542 (GRCm39) Q348R probably damaging Het
Gm21149 G A 5: 15,677,110 (GRCm39) S248F unknown Het
Gpr152 C A 19: 4,192,640 (GRCm39) H60Q probably benign Het
Hdac9 A G 12: 34,362,602 (GRCm39) S612P probably benign Het
Hhipl2 A G 1: 183,199,747 (GRCm39) D102G possibly damaging Het
Hspa9 A G 18: 35,073,294 (GRCm39) V530A possibly damaging Het
Igfbp7 T C 5: 77,549,384 (GRCm39) N173S unknown Het
Ighv1-75 A G 12: 115,797,791 (GRCm39) S44P possibly damaging Het
Iqgap3 C A 3: 88,016,176 (GRCm39) F986L probably damaging Het
Itgax G T 7: 127,735,500 (GRCm39) G523W probably damaging Het
Itih3 A G 14: 30,637,587 (GRCm39) probably null Het
Kcnb2 T C 1: 15,780,523 (GRCm39) I465T probably benign Het
Kmt2b A G 7: 30,279,228 (GRCm39) V1478A probably damaging Het
Ky A T 9: 102,419,411 (GRCm39) I473F probably damaging Het
Lbr A G 1: 181,666,034 (GRCm39) V25A probably damaging Het
Ldlr A G 9: 21,657,135 (GRCm39) T751A probably benign Het
Lrrtm4 A G 6: 80,786,154 (GRCm39) E587G probably damaging Het
Lvrn A C 18: 47,006,847 (GRCm39) probably null Het
Mast2 A T 4: 116,173,044 (GRCm39) C594S probably damaging Het
Mast4 A G 13: 102,910,711 (GRCm39) V644A probably damaging Het
Mcm5 T C 8: 75,842,604 (GRCm39) Y293H probably damaging Het
Mthfd2 A T 6: 83,283,665 (GRCm39) V339E possibly damaging Het
Muc4 A T 16: 32,590,644 (GRCm39) I881F Het
Myo7a A G 7: 97,743,536 (GRCm39) S372P possibly damaging Het
Nbea T A 3: 55,693,879 (GRCm39) K2180* probably null Het
Neb T C 2: 52,101,507 (GRCm39) D4621G probably damaging Het
Nefh C T 11: 4,890,042 (GRCm39) S859N probably benign Het
Nek2 T A 1: 191,563,289 (GRCm39) H384Q possibly damaging Het
Nfkb2 A G 19: 46,298,782 (GRCm39) E645G probably benign Het
Nin G T 12: 70,149,468 (GRCm39) P47Q Het
Nit1 C A 1: 171,171,307 (GRCm39) K178N probably benign Het
Nrap C A 19: 56,317,452 (GRCm39) K1433N probably damaging Het
Nrap T C 19: 56,317,453 (GRCm39) K1433R probably benign Het
Nup85 A G 11: 115,457,463 (GRCm39) Y55C possibly damaging Het
Or2a14 G T 6: 43,130,469 (GRCm39) V77F possibly damaging Het
Pde1b A G 15: 103,411,985 (GRCm39) K29E probably benign Het
Pheta2 G T 15: 82,227,537 (GRCm39) D19Y probably damaging Het
Pheta2 C G 15: 82,227,535 (GRCm39) A18G probably damaging Het
Pik3cg A T 12: 32,226,687 (GRCm39) Y1067N probably benign Het
Pkd1l1 C T 11: 8,799,016 (GRCm39) G2249S probably damaging Het
Plppr4 T A 3: 117,121,976 (GRCm39) T201S possibly damaging Het
Polr1e A G 4: 45,018,678 (GRCm39) T3A probably benign Het
Polr1has A T 17: 37,275,249 (GRCm39) R7S probably benign Het
Pou6f2 G T 13: 18,414,389 (GRCm39) Q129K unknown Het
Ppil4 T A 10: 7,675,341 (GRCm39) D163E probably benign Het
Pradc1 A G 6: 85,424,952 (GRCm39) F82L probably benign Het
Psd3 T C 8: 68,194,414 (GRCm39) K784R probably null Het
Ptgs1 C A 2: 36,141,204 (GRCm39) S550R probably damaging Het
Pxylp1 A G 9: 96,711,030 (GRCm39) L153P probably damaging Het
Rgs10 A C 7: 127,975,729 (GRCm39) F146C probably damaging Het
Rimbp2 G A 5: 128,874,875 (GRCm39) P239S probably damaging Het
Rp1 A G 1: 4,112,255 (GRCm39) Y1199H unknown Het
Rrp12 A T 19: 41,857,231 (GRCm39) M1181K probably benign Het
Rundc3b T C 5: 8,570,982 (GRCm39) N279S probably benign Het
Sbf2 G T 7: 110,027,514 (GRCm39) P494Q probably damaging Het
Scnn1b A G 7: 121,509,693 (GRCm39) T281A probably benign Het
Scube2 A T 7: 109,430,971 (GRCm39) N409K probably damaging Het
Serpina3m A C 12: 104,359,008 (GRCm39) D340A probably damaging Het
Sez6 G A 11: 77,865,121 (GRCm39) E623K possibly damaging Het
Sgpp2 T C 1: 78,367,200 (GRCm39) I111T probably benign Het
Sis T A 3: 72,799,074 (GRCm39) Y1726F possibly damaging Het
Slc17a9 T C 2: 180,374,321 (GRCm39) L129P probably damaging Het
Slc1a5 T A 7: 16,527,729 (GRCm39) F342I probably benign Het
Slc4a4 T A 5: 89,188,205 (GRCm39) probably null Het
Slco3a1 T C 7: 73,952,957 (GRCm39) E534G possibly damaging Het
Smok2b A T 17: 13,454,052 (GRCm39) I71F possibly damaging Het
Tmbim7 A T 5: 3,711,809 (GRCm39) H18L probably damaging Het
Tmem151a A T 19: 5,131,876 (GRCm39) Y443* probably null Het
Tnks1bp1 T G 2: 84,902,125 (GRCm39) S1674A probably benign Het
Trappc11 T A 8: 47,946,348 (GRCm39) I1095F probably damaging Het
Trim11 A G 11: 58,872,864 (GRCm39) R183G possibly damaging Het
Trim29 A G 9: 43,231,797 (GRCm39) D348G probably benign Het
Ttc28 A T 5: 111,433,637 (GRCm39) S2224C probably damaging Het
Vps13d C T 4: 144,875,915 (GRCm39) V1537M Het
Zfp1005 T A 2: 150,110,305 (GRCm39) C332S possibly damaging Het
Zfp184 A G 13: 22,143,665 (GRCm39) D457G possibly damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0494:Shprh UTSW 10 11,032,935 (GRCm39) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GGAATCGTAGCATAACATGTACTAG -3'
(R):5'- GAGAAACCATGGCCTTTGATCTG -3'

Sequencing Primer
(F):5'- TTGTGTCATCAAATTAACAATTAGCC -3'
(R):5'- ATGGCCTTTGATCTGTTTCACAAGAC -3'
Posted On 2022-10-06