Incidental Mutation 'R9710:Cyp4a14'
ID 730051
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Name cytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R9710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 115343397-115353339 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 115349347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 238 (I238F)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
AlphaFold O35728
Predicted Effect probably benign
Transcript: ENSMUST00000030487
AA Change: I238F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: I238F

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 81,946,852 (GRCm39) S250P probably benign Het
Ahcyl1 T A 3: 107,578,494 (GRCm39) I248F possibly damaging Het
Alpk2 T A 18: 65,482,646 (GRCm39) E454V probably damaging Het
Ank3 A T 10: 69,829,070 (GRCm39) T2580S Het
Anks1 G A 17: 28,128,571 (GRCm39) G46R possibly damaging Het
Arhgap45 A G 10: 79,857,635 (GRCm39) E322G probably damaging Het
Arhgef2 T C 3: 88,528,576 (GRCm39) I4T probably benign Het
C1qtnf4 T C 2: 90,720,351 (GRCm39) I208T probably damaging Het
Cachd1 T A 4: 100,832,092 (GRCm39) N751K probably benign Het
Cacna1a G T 8: 85,320,808 (GRCm39) V1589F possibly damaging Het
Cacnb1 T C 11: 97,902,197 (GRCm39) H205R probably benign Het
Castor1 A G 11: 4,169,015 (GRCm39) K61E probably benign Het
Ccdc9b G T 2: 118,591,077 (GRCm39) A152E probably benign Het
Clvs2 C A 10: 33,389,307 (GRCm39) R311L probably benign Het
Crim1 G T 17: 78,610,504 (GRCm39) G320* probably null Het
Crtam A T 9: 40,895,671 (GRCm39) D218E probably benign Het
Cwc27 G A 13: 104,943,158 (GRCm39) T128I probably damaging Het
D930020B18Rik A C 10: 121,503,563 (GRCm39) E246A probably benign Het
Dsg1c T A 18: 20,410,044 (GRCm39) V504E probably benign Het
Enpp6 T A 8: 47,518,948 (GRCm39) S239T probably damaging Het
Eri2 A T 7: 119,384,824 (GRCm39) I559N probably benign Het
Fbxo34 T C 14: 47,768,724 (GRCm39) Y746H probably damaging Het
Galr1 A T 18: 82,424,103 (GRCm39) L58Q probably damaging Het
Ghdc A G 11: 100,658,863 (GRCm39) V423A probably benign Het
Glt28d2 T C 3: 85,779,059 (GRCm39) D138G probably benign Het
Gm266 A T 12: 111,451,763 (GRCm39) C148S probably benign Het
Gnas C T 2: 174,141,132 (GRCm39) T493M unknown Het
Hivep2 T C 10: 14,015,203 (GRCm39) I1790T probably damaging Het
Impg1 A G 9: 80,287,276 (GRCm39) V390A probably benign Het
Isy1 A G 6: 87,796,574 (GRCm39) F239L possibly damaging Het
Itgb5 A G 16: 33,685,917 (GRCm39) T86A probably benign Het
Itpr1 T C 6: 108,382,481 (GRCm39) C1458R possibly damaging Het
Krt28 T C 11: 99,255,921 (GRCm39) E446G probably damaging Het
Lama1 A T 17: 68,129,404 (GRCm39) Q3071L Het
Lasp1 A G 11: 97,697,593 (GRCm39) probably benign Het
Lmf2 T C 15: 89,237,419 (GRCm39) K348E probably benign Het
Lrch3 G T 16: 32,796,108 (GRCm39) E331* probably null Het
Lzic T A 4: 149,573,141 (GRCm39) F98I probably damaging Het
Map7d1 C A 4: 126,127,440 (GRCm39) probably null Het
Marchf8 C T 6: 116,378,405 (GRCm39) T113I possibly damaging Het
Mgrn1 A T 16: 4,745,740 (GRCm39) K423* probably null Het
Muc20 G A 16: 32,615,266 (GRCm39) T37I possibly damaging Het
Myh15 A G 16: 48,959,044 (GRCm39) E972G probably damaging Het
Myocd T A 11: 65,087,167 (GRCm39) K253N probably damaging Het
Myod1 T G 7: 46,026,575 (GRCm39) L160R probably damaging Het
Nanog T C 6: 122,684,799 (GRCm39) S20P probably benign Het
Nat8f2 A T 6: 85,844,683 (GRCm39) Y226* probably null Het
Nsmf A G 2: 24,949,077 (GRCm39) K277R probably null Het
Nsrp1 C T 11: 76,967,503 (GRCm39) G30R probably damaging Het
Nsun6 C A 2: 15,003,009 (GRCm39) R389L probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or10g9 A T 9: 39,912,172 (GRCm39) M117K probably damaging Het
Or11h4 C T 14: 50,974,199 (GRCm39) C140Y probably benign Het
Or51h1 A G 7: 102,308,441 (GRCm39) T138A probably damaging Het
Or5w20 G A 2: 87,726,902 (GRCm39) D120N probably damaging Het
Pgm1 T C 4: 99,843,918 (GRCm39) L567P probably damaging Het
Polrmt G T 10: 79,576,535 (GRCm39) H474N probably benign Het
Ppfia2 A G 10: 106,664,885 (GRCm39) I374V probably benign Het
Pramel5 T A 4: 143,999,545 (GRCm39) I181F probably benign Het
Prpf4b T A 13: 35,083,870 (GRCm39) Y880N probably damaging Het
Ptpn3 G A 4: 57,249,957 (GRCm39) Q180* probably null Het
Ptprc T C 1: 138,008,627 (GRCm39) R687G probably damaging Het
Rnaseh2a T C 8: 85,684,638 (GRCm39) T241A probably damaging Het
Rnf148 T A 6: 23,654,802 (GRCm39) I65F possibly damaging Het
Rnf213 A G 11: 119,331,831 (GRCm39) I2348V Het
Rttn A G 18: 89,035,334 (GRCm39) N736S possibly damaging Het
Ryr3 A C 2: 112,633,534 (GRCm39) V2093G probably damaging Het
Selenof T A 3: 144,283,370 (GRCm39) F33L probably benign Het
Sh2d3c C T 2: 32,635,889 (GRCm39) R238* probably null Het
Slc23a4 T C 6: 34,923,235 (GRCm39) K543R probably benign Het
Smn1 A T 13: 100,272,210 (GRCm39) N278I possibly damaging Het
Sox7 G A 14: 64,185,509 (GRCm39) A182T probably benign Het
Spata31e5 T A 1: 28,817,120 (GRCm39) Y304F probably benign Het
Sptlc2 A T 12: 87,359,533 (GRCm39) I501N probably benign Het
Srf T C 17: 46,866,271 (GRCm39) T162A probably benign Het
Srm C T 4: 148,676,039 (GRCm39) probably benign Het
Stim1 CAGCGCCTGACGGAGC CAGC 7: 102,080,118 (GRCm39) probably benign Het
Taar8a T C 10: 23,952,714 (GRCm39) L106P probably damaging Het
Tcte1 A G 17: 45,850,798 (GRCm39) H358R possibly damaging Het
Tmem205 A G 9: 21,837,587 (GRCm39) S20P probably damaging Het
Trav16 T A 14: 53,980,910 (GRCm39) V33E possibly damaging Het
Trf T A 9: 103,103,217 (GRCm39) I149F probably damaging Het
Trmt2a C T 16: 18,070,041 (GRCm39) Q419* probably null Het
Ttc19 A G 11: 62,203,997 (GRCm39) I319M probably benign Het
Txndc16 T C 14: 45,400,467 (GRCm39) I345V probably benign Het
Ube3b T C 5: 114,553,370 (GRCm39) I914T probably benign Het
Ubr3 T C 2: 69,727,957 (GRCm39) F107L possibly damaging Het
Vmn1r73 T C 7: 11,490,407 (GRCm39) F75S possibly damaging Het
Vmn2r54 A T 7: 12,363,753 (GRCm39) M380K possibly damaging Het
Wdr7 T A 18: 63,927,317 (GRCm39) M989K possibly damaging Het
Zcchc3 A G 2: 152,256,385 (GRCm39) S105P probably benign Het
Zfp735 T A 11: 73,601,806 (GRCm39) V250E possibly damaging Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115,347,149 (GRCm39) splice site probably benign
IGL01539:Cyp4a14 APN 4 115,344,374 (GRCm39) missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115,352,134 (GRCm39) nonsense probably null
IGL02309:Cyp4a14 APN 4 115,348,829 (GRCm39) missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115,352,224 (GRCm39) splice site probably benign
IGL03302:Cyp4a14 APN 4 115,348,575 (GRCm39) missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115,347,193 (GRCm39) missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115,349,367 (GRCm39) missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115,348,588 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115,344,498 (GRCm39) missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115,348,331 (GRCm39) missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115,353,133 (GRCm39) missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115,353,126 (GRCm39) missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R5150:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R5930:Cyp4a14 UTSW 4 115,348,607 (GRCm39) missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115,353,297 (GRCm39) nonsense probably null
R6269:Cyp4a14 UTSW 4 115,348,328 (GRCm39) missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115,344,441 (GRCm39) missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115,353,280 (GRCm39) missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R6563:Cyp4a14 UTSW 4 115,349,283 (GRCm39) missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115,348,391 (GRCm39) missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115,348,278 (GRCm39) missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115,348,358 (GRCm39) missense probably damaging 1.00
R7379:Cyp4a14 UTSW 4 115,350,907 (GRCm39) splice site probably null
R7544:Cyp4a14 UTSW 4 115,348,283 (GRCm39) missense probably damaging 0.98
R7591:Cyp4a14 UTSW 4 115,347,157 (GRCm39) critical splice donor site probably null
R7740:Cyp4a14 UTSW 4 115,350,806 (GRCm39) missense probably damaging 1.00
R7741:Cyp4a14 UTSW 4 115,347,156 (GRCm39) splice site probably null
R7753:Cyp4a14 UTSW 4 115,350,861 (GRCm39) missense probably damaging 1.00
R7789:Cyp4a14 UTSW 4 115,352,107 (GRCm39) missense probably benign 0.00
R8064:Cyp4a14 UTSW 4 115,352,155 (GRCm39) missense probably benign
R8311:Cyp4a14 UTSW 4 115,348,275 (GRCm39) missense probably damaging 1.00
R8458:Cyp4a14 UTSW 4 115,353,129 (GRCm39) missense probably damaging 1.00
R8868:Cyp4a14 UTSW 4 115,348,553 (GRCm39) missense probably damaging 1.00
R9039:Cyp4a14 UTSW 4 115,344,461 (GRCm39) missense probably damaging 0.97
R9632:Cyp4a14 UTSW 4 115,349,347 (GRCm39) missense probably benign 0.00
Z1176:Cyp4a14 UTSW 4 115,347,214 (GRCm39) missense probably benign 0.01
Z1177:Cyp4a14 UTSW 4 115,348,650 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATACCTCAAGCCCTGCAGAG -3'
(R):5'- AGAAGCTCAGTTGGTCATCC -3'

Sequencing Primer
(F):5'- CAGAGGTGTCTGGTAAACTCATTATG -3'
(R):5'- ATTGTGTGCCCCATGGTCAAAAG -3'
Posted On 2022-10-06