Incidental Mutation 'R9710:Ube3b'
ID 730056
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R9710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114518668-114559230 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114553370 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 914 (I914T)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: I914T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I914T

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 81,946,852 (GRCm39) S250P probably benign Het
Ahcyl1 T A 3: 107,578,494 (GRCm39) I248F possibly damaging Het
Alpk2 T A 18: 65,482,646 (GRCm39) E454V probably damaging Het
Ank3 A T 10: 69,829,070 (GRCm39) T2580S Het
Anks1 G A 17: 28,128,571 (GRCm39) G46R possibly damaging Het
Arhgap45 A G 10: 79,857,635 (GRCm39) E322G probably damaging Het
Arhgef2 T C 3: 88,528,576 (GRCm39) I4T probably benign Het
C1qtnf4 T C 2: 90,720,351 (GRCm39) I208T probably damaging Het
Cachd1 T A 4: 100,832,092 (GRCm39) N751K probably benign Het
Cacna1a G T 8: 85,320,808 (GRCm39) V1589F possibly damaging Het
Cacnb1 T C 11: 97,902,197 (GRCm39) H205R probably benign Het
Castor1 A G 11: 4,169,015 (GRCm39) K61E probably benign Het
Ccdc9b G T 2: 118,591,077 (GRCm39) A152E probably benign Het
Clvs2 C A 10: 33,389,307 (GRCm39) R311L probably benign Het
Crim1 G T 17: 78,610,504 (GRCm39) G320* probably null Het
Crtam A T 9: 40,895,671 (GRCm39) D218E probably benign Het
Cwc27 G A 13: 104,943,158 (GRCm39) T128I probably damaging Het
Cyp4a14 T A 4: 115,349,347 (GRCm39) I238F probably benign Het
D930020B18Rik A C 10: 121,503,563 (GRCm39) E246A probably benign Het
Dsg1c T A 18: 20,410,044 (GRCm39) V504E probably benign Het
Enpp6 T A 8: 47,518,948 (GRCm39) S239T probably damaging Het
Eri2 A T 7: 119,384,824 (GRCm39) I559N probably benign Het
Fbxo34 T C 14: 47,768,724 (GRCm39) Y746H probably damaging Het
Galr1 A T 18: 82,424,103 (GRCm39) L58Q probably damaging Het
Ghdc A G 11: 100,658,863 (GRCm39) V423A probably benign Het
Glt28d2 T C 3: 85,779,059 (GRCm39) D138G probably benign Het
Gm266 A T 12: 111,451,763 (GRCm39) C148S probably benign Het
Gnas C T 2: 174,141,132 (GRCm39) T493M unknown Het
Hivep2 T C 10: 14,015,203 (GRCm39) I1790T probably damaging Het
Impg1 A G 9: 80,287,276 (GRCm39) V390A probably benign Het
Isy1 A G 6: 87,796,574 (GRCm39) F239L possibly damaging Het
Itgb5 A G 16: 33,685,917 (GRCm39) T86A probably benign Het
Itpr1 T C 6: 108,382,481 (GRCm39) C1458R possibly damaging Het
Krt28 T C 11: 99,255,921 (GRCm39) E446G probably damaging Het
Lama1 A T 17: 68,129,404 (GRCm39) Q3071L Het
Lasp1 A G 11: 97,697,593 (GRCm39) probably benign Het
Lmf2 T C 15: 89,237,419 (GRCm39) K348E probably benign Het
Lrch3 G T 16: 32,796,108 (GRCm39) E331* probably null Het
Lzic T A 4: 149,573,141 (GRCm39) F98I probably damaging Het
Map7d1 C A 4: 126,127,440 (GRCm39) probably null Het
Marchf8 C T 6: 116,378,405 (GRCm39) T113I possibly damaging Het
Mgrn1 A T 16: 4,745,740 (GRCm39) K423* probably null Het
Muc20 G A 16: 32,615,266 (GRCm39) T37I possibly damaging Het
Myh15 A G 16: 48,959,044 (GRCm39) E972G probably damaging Het
Myocd T A 11: 65,087,167 (GRCm39) K253N probably damaging Het
Myod1 T G 7: 46,026,575 (GRCm39) L160R probably damaging Het
Nanog T C 6: 122,684,799 (GRCm39) S20P probably benign Het
Nat8f2 A T 6: 85,844,683 (GRCm39) Y226* probably null Het
Nsmf A G 2: 24,949,077 (GRCm39) K277R probably null Het
Nsrp1 C T 11: 76,967,503 (GRCm39) G30R probably damaging Het
Nsun6 C A 2: 15,003,009 (GRCm39) R389L probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or10g9 A T 9: 39,912,172 (GRCm39) M117K probably damaging Het
Or11h4 C T 14: 50,974,199 (GRCm39) C140Y probably benign Het
Or51h1 A G 7: 102,308,441 (GRCm39) T138A probably damaging Het
Or5w20 G A 2: 87,726,902 (GRCm39) D120N probably damaging Het
Pgm1 T C 4: 99,843,918 (GRCm39) L567P probably damaging Het
Polrmt G T 10: 79,576,535 (GRCm39) H474N probably benign Het
Ppfia2 A G 10: 106,664,885 (GRCm39) I374V probably benign Het
Pramel5 T A 4: 143,999,545 (GRCm39) I181F probably benign Het
Prpf4b T A 13: 35,083,870 (GRCm39) Y880N probably damaging Het
Ptpn3 G A 4: 57,249,957 (GRCm39) Q180* probably null Het
Ptprc T C 1: 138,008,627 (GRCm39) R687G probably damaging Het
Rnaseh2a T C 8: 85,684,638 (GRCm39) T241A probably damaging Het
Rnf148 T A 6: 23,654,802 (GRCm39) I65F possibly damaging Het
Rnf213 A G 11: 119,331,831 (GRCm39) I2348V Het
Rttn A G 18: 89,035,334 (GRCm39) N736S possibly damaging Het
Ryr3 A C 2: 112,633,534 (GRCm39) V2093G probably damaging Het
Selenof T A 3: 144,283,370 (GRCm39) F33L probably benign Het
Sh2d3c C T 2: 32,635,889 (GRCm39) R238* probably null Het
Slc23a4 T C 6: 34,923,235 (GRCm39) K543R probably benign Het
Smn1 A T 13: 100,272,210 (GRCm39) N278I possibly damaging Het
Sox7 G A 14: 64,185,509 (GRCm39) A182T probably benign Het
Spata31e5 T A 1: 28,817,120 (GRCm39) Y304F probably benign Het
Sptlc2 A T 12: 87,359,533 (GRCm39) I501N probably benign Het
Srf T C 17: 46,866,271 (GRCm39) T162A probably benign Het
Srm C T 4: 148,676,039 (GRCm39) probably benign Het
Stim1 CAGCGCCTGACGGAGC CAGC 7: 102,080,118 (GRCm39) probably benign Het
Taar8a T C 10: 23,952,714 (GRCm39) L106P probably damaging Het
Tcte1 A G 17: 45,850,798 (GRCm39) H358R possibly damaging Het
Tmem205 A G 9: 21,837,587 (GRCm39) S20P probably damaging Het
Trav16 T A 14: 53,980,910 (GRCm39) V33E possibly damaging Het
Trf T A 9: 103,103,217 (GRCm39) I149F probably damaging Het
Trmt2a C T 16: 18,070,041 (GRCm39) Q419* probably null Het
Ttc19 A G 11: 62,203,997 (GRCm39) I319M probably benign Het
Txndc16 T C 14: 45,400,467 (GRCm39) I345V probably benign Het
Ubr3 T C 2: 69,727,957 (GRCm39) F107L possibly damaging Het
Vmn1r73 T C 7: 11,490,407 (GRCm39) F75S possibly damaging Het
Vmn2r54 A T 7: 12,363,753 (GRCm39) M380K possibly damaging Het
Wdr7 T A 18: 63,927,317 (GRCm39) M989K possibly damaging Het
Zcchc3 A G 2: 152,256,385 (GRCm39) S105P probably benign Het
Zfp735 T A 11: 73,601,806 (GRCm39) V250E possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114,553,348 (GRCm39) missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114,544,313 (GRCm39) missense probably null 0.86
IGL02632:Ube3b APN 5 114,536,902 (GRCm39) missense probably benign
IGL02850:Ube3b APN 5 114,544,310 (GRCm39) missense probably damaging 1.00
IGL02878:Ube3b APN 5 114,542,778 (GRCm39) splice site probably null
IGL02881:Ube3b APN 5 114,550,945 (GRCm39) missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114,536,912 (GRCm39) missense probably benign 0.17
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0071:Ube3b UTSW 5 114,557,558 (GRCm39) missense probably damaging 1.00
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0076:Ube3b UTSW 5 114,546,278 (GRCm39) critical splice donor site probably null
R0111:Ube3b UTSW 5 114,528,437 (GRCm39) splice site probably benign
R0309:Ube3b UTSW 5 114,557,530 (GRCm39) splice site probably benign
R0718:Ube3b UTSW 5 114,540,616 (GRCm39) nonsense probably null
R1344:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1350:Ube3b UTSW 5 114,544,198 (GRCm39) splice site probably null
R1418:Ube3b UTSW 5 114,556,636 (GRCm39) missense probably damaging 1.00
R1732:Ube3b UTSW 5 114,525,506 (GRCm39) missense probably benign 0.01
R1764:Ube3b UTSW 5 114,542,678 (GRCm39) missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114,537,926 (GRCm39) missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2015:Ube3b UTSW 5 114,549,210 (GRCm39) missense probably damaging 1.00
R2041:Ube3b UTSW 5 114,525,294 (GRCm39) missense probably damaging 0.99
R2074:Ube3b UTSW 5 114,553,316 (GRCm39) missense probably benign 0.14
R2202:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R2205:Ube3b UTSW 5 114,527,135 (GRCm39) missense probably damaging 1.00
R3826:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3829:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3830:Ube3b UTSW 5 114,538,012 (GRCm39) missense probably damaging 0.99
R3927:Ube3b UTSW 5 114,553,741 (GRCm39) missense probably benign 0.03
R3974:Ube3b UTSW 5 114,550,491 (GRCm39) missense probably benign 0.05
R4049:Ube3b UTSW 5 114,550,931 (GRCm39) missense probably benign 0.09
R4096:Ube3b UTSW 5 114,531,147 (GRCm39) missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114,536,489 (GRCm39) missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114,550,505 (GRCm39) missense probably damaging 1.00
R4688:Ube3b UTSW 5 114,531,139 (GRCm39) missense probably benign 0.03
R4779:Ube3b UTSW 5 114,542,778 (GRCm39) splice site probably null
R4824:Ube3b UTSW 5 114,553,787 (GRCm39) splice site probably null
R4868:Ube3b UTSW 5 114,536,488 (GRCm39) missense probably benign 0.00
R4953:Ube3b UTSW 5 114,539,471 (GRCm39) missense probably benign 0.01
R5013:Ube3b UTSW 5 114,545,702 (GRCm39) missense probably damaging 1.00
R5057:Ube3b UTSW 5 114,544,318 (GRCm39) missense probably benign 0.01
R5117:Ube3b UTSW 5 114,557,692 (GRCm39) missense probably damaging 0.96
R5131:Ube3b UTSW 5 114,545,607 (GRCm39) missense probably damaging 1.00
R5498:Ube3b UTSW 5 114,556,635 (GRCm39) missense probably damaging 1.00
R5564:Ube3b UTSW 5 114,527,136 (GRCm39) missense probably damaging 1.00
R5572:Ube3b UTSW 5 114,544,240 (GRCm39) missense probably damaging 0.99
R5580:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R5596:Ube3b UTSW 5 114,544,221 (GRCm39) splice site probably null
R5843:Ube3b UTSW 5 114,550,360 (GRCm39) missense probably damaging 1.00
R5910:Ube3b UTSW 5 114,553,370 (GRCm39) missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R6691:Ube3b UTSW 5 114,546,185 (GRCm39) missense probably benign 0.00
R7148:Ube3b UTSW 5 114,544,313 (GRCm39) missense probably damaging 0.97
R7334:Ube3b UTSW 5 114,553,742 (GRCm39) missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114,556,687 (GRCm39) missense probably damaging 1.00
R7438:Ube3b UTSW 5 114,553,345 (GRCm39) missense possibly damaging 0.79
R7640:Ube3b UTSW 5 114,553,384 (GRCm39) missense probably benign
R7825:Ube3b UTSW 5 114,539,373 (GRCm39) missense probably damaging 1.00
R7958:Ube3b UTSW 5 114,539,484 (GRCm39) missense probably benign 0.05
R8025:Ube3b UTSW 5 114,546,270 (GRCm39) missense probably damaging 0.99
R8058:Ube3b UTSW 5 114,544,846 (GRCm39) missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114,550,550 (GRCm39) critical splice donor site probably null
R8182:Ube3b UTSW 5 114,530,199 (GRCm39) missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114,540,747 (GRCm39) missense probably benign 0.04
R8465:Ube3b UTSW 5 114,528,451 (GRCm39) missense probably damaging 1.00
R8682:Ube3b UTSW 5 114,550,351 (GRCm39) missense probably damaging 1.00
R8708:Ube3b UTSW 5 114,531,151 (GRCm39) missense probably benign 0.34
R8758:Ube3b UTSW 5 114,553,261 (GRCm39) critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114,526,800 (GRCm39) missense probably damaging 1.00
R9058:Ube3b UTSW 5 114,553,300 (GRCm39) missense probably benign 0.05
R9072:Ube3b UTSW 5 114,542,607 (GRCm39) missense probably damaging 0.98
R9116:Ube3b UTSW 5 114,542,837 (GRCm39) intron probably benign
R9537:Ube3b UTSW 5 114,525,245 (GRCm39) missense probably damaging 1.00
R9596:Ube3b UTSW 5 114,527,171 (GRCm39) missense probably damaging 1.00
R9632:Ube3b UTSW 5 114,553,370 (GRCm39) missense probably benign 0.00
X0017:Ube3b UTSW 5 114,553,646 (GRCm39) missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTCTTAGCATGCTTGGCAGC -3'
(R):5'- GAAACTAAATGGGCTGTCATCAG -3'

Sequencing Primer
(F):5'- CCTAGCCAGCTCATCCCAGTG -3'
(R):5'- GGATACCAGAGTCACTCTATGTCAG -3'
Posted On 2022-10-06