Mutagenetix > Incidental Mutation

Incidental Mutation 'R9710:Ube3b'

730056

Institutional Source

Beutler Lab

Gene Symbol

Ube3b

Ensembl Gene

ENSMUSG00000029577

Gene Name

ubiquitin protein ligase E3B

Synonyms

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R9710 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114380607-114421169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114415309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 914 (I914T)

Ref Sequence

ENSEMBL: ENSMUSP00000073652 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]

AlphaFold

Q9ES34

Predicted Effect

probably benign
Transcript: ENSMUST00000074002
AA Change: I914T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I914T

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	412	428	N/A	INTRINSIC
low complexity region	470	488	N/A	INTRINSIC
HECTc	697	1070	2.15e-110	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000130169

SMART Domains

Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
IQ	28	50	1.17e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196651

SMART Domains

Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

Domain	Start	End	E-Value	Type
HECTc	122	495	1.1e-112	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	T	C	15: 82,062,651	S250P	probably benign	Het
A430105I19Rik	G	T	2: 118,760,596	A152E	probably benign	Het
Ahcyl1	T	A	3: 107,671,178	I248F	possibly damaging	Het
Alpk2	T	A	18: 65,349,575	E454V	probably damaging	Het
Ank3	A	T	10: 69,993,240	T2580S		Het
Anks1	G	A	17: 27,909,597	G46R	possibly damaging	Het
Arhgap45	A	G	10: 80,021,801	E322G	probably damaging	Het
Arhgef2	T	C	3: 88,621,269	I4T	probably benign	Het
C1qtnf4	T	C	2: 90,890,007	I208T	probably damaging	Het
Cachd1	T	A	4: 100,974,895	N751K	probably benign	Het
Cacna1a	G	T	8: 84,594,179	V1589F	possibly damaging	Het
Cacnb1	T	C	11: 98,011,371	H205R	probably benign	Het
Clvs2	C	A	10: 33,513,311	R311L	probably benign	Het
Crim1	G	T	17: 78,303,075	G320*	probably null	Het
Crtam	A	T	9: 40,984,375	D218E	probably benign	Het
Cwc27	G	A	13: 104,806,650	T128I	probably damaging	Het
Cyp4a14	T	A	4: 115,492,150	I238F	probably benign	Het
D930020B18Rik	A	C	10: 121,667,658	E246A	probably benign	Het
Dsg1c	T	A	18: 20,276,987	V504E	probably benign	Het
Enpp6	T	A	8: 47,065,913	S239T	probably damaging	Het
Eri2	A	T	7: 119,785,601	I559N	probably benign	Het
Fbxo34	T	C	14: 47,531,267	Y746H	probably damaging	Het
Galr1	A	T	18: 82,405,978	L58Q	probably damaging	Het
Gatsl3	A	G	11: 4,219,015	K61E	probably benign	Het
Ghdc	A	G	11: 100,768,037	V423A	probably benign	Het
Glt28d2	T	C	3: 85,871,752	D138G	probably benign	Het
Gm266	A	T	12: 111,485,329	C148S	probably benign	Het
Gm597	T	A	1: 28,778,039	Y304F	probably benign	Het
Gnas	C	T	2: 174,299,339	T493M	unknown	Het
Hivep2	T	C	10: 14,139,459	I1790T	probably damaging	Het
Impg1	A	G	9: 80,379,994	V390A	probably benign	Het
Isy1	A	G	6: 87,819,592	F239L	possibly damaging	Het
Itgb5	A	G	16: 33,865,547	T86A	probably benign	Het
Itpr1	T	C	6: 108,405,520	C1458R	possibly damaging	Het
Krt28	T	C	11: 99,365,095	E446G	probably damaging	Het
Lama1	A	T	17: 67,822,409	Q3071L		Het
Lasp1	A	G	11: 97,806,767		probably benign	Het
Lmf2	T	C	15: 89,353,216	K348E	probably benign	Het
Lrch3	G	T	16: 32,975,738	E331*	probably null	Het
Lzic	T	A	4: 149,488,684	F98I	probably damaging	Het
Map7d1	C	A	4: 126,233,647		probably null	Het
March8	C	T	6: 116,401,444	T113I	possibly damaging	Het
Mgrn1	A	T	16: 4,927,876	K423*	probably null	Het
Muc20	G	A	16: 32,794,896	T37I	possibly damaging	Het
Myh15	A	G	16: 49,138,681	E972G	probably damaging	Het
Myocd	T	A	11: 65,196,341	K253N	probably damaging	Het
Myod1	T	G	7: 46,377,151	L160R	probably damaging	Het
Nanog	T	C	6: 122,707,840	S20P	probably benign	Het
Nat8f2	A	T	6: 85,867,701	Y226*	probably null	Het
Nsmf	A	G	2: 25,059,065	K277R	probably null	Het
Nsrp1	C	T	11: 77,076,677	G30R	probably damaging	Het
Nsun6	C	A	2: 14,998,198	R389L	probably benign	Het
Obscn	G	A	11: 59,052,571	R4251C	probably benign	Het
Olfr1153	G	A	2: 87,896,558	D120N	probably damaging	Het
Olfr555	A	G	7: 102,659,234	T138A	probably damaging	Het
Olfr749	C	T	14: 50,736,742	C140Y	probably benign	Het
Olfr979	A	T	9: 40,000,876	M117K	probably damaging	Het
Pgm2	T	C	4: 99,986,721	L567P	probably damaging	Het
Polrmt	G	T	10: 79,740,701	H474N	probably benign	Het
Ppfia2	A	G	10: 106,829,024	I374V	probably benign	Het
Pramel5	T	A	4: 144,272,975	I181F	probably benign	Het
Prpf4b	T	A	13: 34,899,887	Y880N	probably damaging	Het
Ptpn3	G	A	4: 57,249,957	Q180*	probably null	Het
Ptprc	T	C	1: 138,080,889	R687G	probably damaging	Het
Rnaseh2a	T	C	8: 84,958,009	T241A	probably damaging	Het
Rnf148	T	A	6: 23,654,803	I65F	possibly damaging	Het
Rnf213	A	G	11: 119,441,005	I2348V		Het
Rttn	A	G	18: 89,017,210	N736S	possibly damaging	Het
Ryr3	A	C	2: 112,803,189	V2093G	probably damaging	Het
Selenof	T	A	3: 144,577,609	F33L	probably benign	Het
Sh2d3c	C	T	2: 32,745,877	R238*	probably null	Het
Slc23a4	T	C	6: 34,946,300	K543R	probably benign	Het
Smn1	A	T	13: 100,135,702	N278I	possibly damaging	Het
Sox7	G	A	14: 63,948,060	A182T	probably benign	Het
Sptlc2	A	T	12: 87,312,759	I501N	probably benign	Het
Srf	T	C	17: 46,555,345	T162A	probably benign	Het
Srm	C	T	4: 148,591,582		probably benign	Het
Stim1	CAGCGCCTGACGGAGC	CAGC	7: 102,430,911		probably benign	Het
Taar8a	T	C	10: 24,076,816	L106P	probably damaging	Het
Tcte1	A	G	17: 45,539,872	H358R	possibly damaging	Het
Tmem205	A	G	9: 21,926,291	S20P	probably damaging	Het
Trav16	T	A	14: 53,743,453	V33E	possibly damaging	Het
Trf	T	A	9: 103,226,018	I149F	probably damaging	Het
Trmt2a	C	T	16: 18,252,177	Q419*	probably null	Het
Ttc19	A	G	11: 62,313,171	I319M	probably benign	Het
Txndc16	T	C	14: 45,163,010	I345V	probably benign	Het
Ubr3	T	C	2: 69,897,613	F107L	possibly damaging	Het
Vmn1r73	T	C	7: 11,756,480	F75S	possibly damaging	Het
Vmn2r54	A	T	7: 12,629,826	M380K	possibly damaging	Het
Wdr7	T	A	18: 63,794,246	M989K	possibly damaging	Het
Zcchc3	A	G	2: 152,414,465	S105P	probably benign	Het
Zfp735	T	A	11: 73,710,980	V250E	possibly damaging	Het

Other mutations in Ube3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00754:Ube3b	APN	5	114415287	missense	possibly damaging	0.93
IGL01154:Ube3b	APN	5	114406252	missense	probably null	0.86
IGL02632:Ube3b	APN	5	114398841	missense	probably benign
IGL02850:Ube3b	APN	5	114406249	missense	probably damaging	1.00
IGL02878:Ube3b	APN	5	114404717	splice site	probably null
IGL02881:Ube3b	APN	5	114412884	missense	possibly damaging	0.78
R0003:Ube3b	UTSW	5	114398851	missense	probably benign	0.17
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0071:Ube3b	UTSW	5	114419497	missense	probably damaging	1.00
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0076:Ube3b	UTSW	5	114408217	critical splice donor site	probably null
R0111:Ube3b	UTSW	5	114390376	splice site	probably benign
R0309:Ube3b	UTSW	5	114419469	splice site	probably benign
R0718:Ube3b	UTSW	5	114402555	nonsense	probably null
R1344:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1350:Ube3b	UTSW	5	114406137	splice site	probably null
R1418:Ube3b	UTSW	5	114418575	missense	probably damaging	1.00
R1732:Ube3b	UTSW	5	114387445	missense	probably benign	0.01
R1764:Ube3b	UTSW	5	114404617	missense	possibly damaging	0.89
R1975:Ube3b	UTSW	5	114399865	missense	possibly damaging	0.80
R2014:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2015:Ube3b	UTSW	5	114411149	missense	probably damaging	1.00
R2041:Ube3b	UTSW	5	114387233	missense	probably damaging	0.99
R2074:Ube3b	UTSW	5	114415255	missense	probably benign	0.14
R2202:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R2205:Ube3b	UTSW	5	114389074	missense	probably damaging	1.00
R3826:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3829:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3830:Ube3b	UTSW	5	114399951	missense	probably damaging	0.99
R3927:Ube3b	UTSW	5	114415680	missense	probably benign	0.03
R3974:Ube3b	UTSW	5	114412430	missense	probably benign	0.05
R4049:Ube3b	UTSW	5	114412870	missense	probably benign	0.09
R4096:Ube3b	UTSW	5	114393086	missense	possibly damaging	0.65
R4261:Ube3b	UTSW	5	114398428	missense	possibly damaging	0.80
R4415:Ube3b	UTSW	5	114412444	missense	probably damaging	1.00
R4688:Ube3b	UTSW	5	114393078	missense	probably benign	0.03
R4779:Ube3b	UTSW	5	114404717	splice site	probably null
R4824:Ube3b	UTSW	5	114415726	splice site	probably null
R4868:Ube3b	UTSW	5	114398427	missense	probably benign	0.00
R4953:Ube3b	UTSW	5	114401410	missense	probably benign	0.01
R5013:Ube3b	UTSW	5	114407641	missense	probably damaging	1.00
R5057:Ube3b	UTSW	5	114406257	missense	probably benign	0.01
R5117:Ube3b	UTSW	5	114419631	missense	probably damaging	0.96
R5131:Ube3b	UTSW	5	114407546	missense	probably damaging	1.00
R5498:Ube3b	UTSW	5	114418574	missense	probably damaging	1.00
R5564:Ube3b	UTSW	5	114389075	missense	probably damaging	1.00
R5572:Ube3b	UTSW	5	114406179	missense	probably damaging	0.99
R5580:Ube3b	UTSW	5	114415323	missense	probably benign
R5596:Ube3b	UTSW	5	114406160	splice site	probably null
R5843:Ube3b	UTSW	5	114412299	missense	probably damaging	1.00
R5910:Ube3b	UTSW	5	114415309	missense	possibly damaging	0.63
R6591:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R6691:Ube3b	UTSW	5	114408124	missense	probably benign	0.00
R7148:Ube3b	UTSW	5	114406252	missense	probably damaging	0.97
R7334:Ube3b	UTSW	5	114415681	missense	possibly damaging	0.64
R7438:Ube3b	UTSW	5	114415284	missense	possibly damaging	0.79
R7438:Ube3b	UTSW	5	114418626	missense	probably damaging	1.00
R7640:Ube3b	UTSW	5	114415323	missense	probably benign
R7825:Ube3b	UTSW	5	114401312	missense	probably damaging	1.00
R7958:Ube3b	UTSW	5	114401423	missense	probably benign	0.05
R8025:Ube3b	UTSW	5	114408209	missense	probably damaging	0.99
R8058:Ube3b	UTSW	5	114406785	missense	possibly damaging	0.58
R8087:Ube3b	UTSW	5	114412489	critical splice donor site	probably null
R8182:Ube3b	UTSW	5	114392138	missense	possibly damaging	0.77
R8322:Ube3b	UTSW	5	114402686	missense	probably benign	0.04
R8465:Ube3b	UTSW	5	114390390	missense	probably damaging	1.00
R8682:Ube3b	UTSW	5	114412290	missense	probably damaging	1.00
R8708:Ube3b	UTSW	5	114393090	missense	probably benign	0.34
R8758:Ube3b	UTSW	5	114415200	critical splice acceptor site	probably benign
R8784:Ube3b	UTSW	5	114388739	missense	probably damaging	1.00
R9058:Ube3b	UTSW	5	114415239	missense	probably benign	0.05
R9072:Ube3b	UTSW	5	114404546	missense	probably damaging	0.98
R9116:Ube3b	UTSW	5	114404776	intron	probably benign
R9537:Ube3b	UTSW	5	114387184	missense	probably damaging	1.00
R9596:Ube3b	UTSW	5	114389110	missense	probably damaging	1.00
R9632:Ube3b	UTSW	5	114415309	missense	probably benign	0.00
X0017:Ube3b	UTSW	5	114415585	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- CTCTTAGCATGCTTGGCAGC -3'
(R):5'- GAAACTAAATGGGCTGTCATCAG -3'

Sequencing Primer
(F):5'- CCTAGCCAGCTCATCCCAGTG -3'
(R):5'- GGATACCAGAGTCACTCTATGTCAG -3'

Posted On

2022-10-06