Incidental Mutation 'R9710:Ube3b'
ID 730056
Institutional Source Beutler Lab
Gene Symbol Ube3b
Ensembl Gene ENSMUSG00000029577
Gene Name ubiquitin protein ligase E3B
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R9710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114380607-114421169 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114415309 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 914 (I914T)
Ref Sequence ENSEMBL: ENSMUSP00000073652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074002] [ENSMUST00000130169]
AlphaFold Q9ES34
Predicted Effect probably benign
Transcript: ENSMUST00000074002
AA Change: I914T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073652
Gene: ENSMUSG00000029577
AA Change: I914T

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
low complexity region 310 327 N/A INTRINSIC
low complexity region 412 428 N/A INTRINSIC
low complexity region 470 488 N/A INTRINSIC
HECTc 697 1070 2.15e-110 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130169
SMART Domains Protein: ENSMUSP00000138723
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
IQ 28 50 1.17e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196651
SMART Domains Protein: ENSMUSP00000143455
Gene: ENSMUSG00000029577

DomainStartEndE-ValueType
HECTc 122 495 1.1e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: E1 ubiquitin-activating enzymes, E2 ubiquitin-conjugating enzymes, and E3 ubiquitin-protein ligases. This gene encodes a member of the E3 ubiquitin-conjugating enzyme family which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme and transfers the ubiquitin to the targeted substrates. A HECT (homology to E6-AP C-terminus) domain in the C-terminus of the longer isoform of this protein is the catalytic site of ubiquitin transfer and forms a complex with E2 conjugases. Shorter isoforms of this protein which lack the C-terminal HECT domain are therefore unlikely to bind E2 enzymes. Alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit preweaning lethality, reduced fertility, decreased growth, reduced grip strength, impaired hearing, eye inflammation and decreased cholesterol level. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 82,062,651 S250P probably benign Het
A430105I19Rik G T 2: 118,760,596 A152E probably benign Het
Ahcyl1 T A 3: 107,671,178 I248F possibly damaging Het
Alpk2 T A 18: 65,349,575 E454V probably damaging Het
Ank3 A T 10: 69,993,240 T2580S Het
Anks1 G A 17: 27,909,597 G46R possibly damaging Het
Arhgap45 A G 10: 80,021,801 E322G probably damaging Het
Arhgef2 T C 3: 88,621,269 I4T probably benign Het
C1qtnf4 T C 2: 90,890,007 I208T probably damaging Het
Cachd1 T A 4: 100,974,895 N751K probably benign Het
Cacna1a G T 8: 84,594,179 V1589F possibly damaging Het
Cacnb1 T C 11: 98,011,371 H205R probably benign Het
Clvs2 C A 10: 33,513,311 R311L probably benign Het
Crim1 G T 17: 78,303,075 G320* probably null Het
Crtam A T 9: 40,984,375 D218E probably benign Het
Cwc27 G A 13: 104,806,650 T128I probably damaging Het
Cyp4a14 T A 4: 115,492,150 I238F probably benign Het
D930020B18Rik A C 10: 121,667,658 E246A probably benign Het
Dsg1c T A 18: 20,276,987 V504E probably benign Het
Enpp6 T A 8: 47,065,913 S239T probably damaging Het
Eri2 A T 7: 119,785,601 I559N probably benign Het
Fbxo34 T C 14: 47,531,267 Y746H probably damaging Het
Galr1 A T 18: 82,405,978 L58Q probably damaging Het
Gatsl3 A G 11: 4,219,015 K61E probably benign Het
Ghdc A G 11: 100,768,037 V423A probably benign Het
Glt28d2 T C 3: 85,871,752 D138G probably benign Het
Gm266 A T 12: 111,485,329 C148S probably benign Het
Gm597 T A 1: 28,778,039 Y304F probably benign Het
Gnas C T 2: 174,299,339 T493M unknown Het
Hivep2 T C 10: 14,139,459 I1790T probably damaging Het
Impg1 A G 9: 80,379,994 V390A probably benign Het
Isy1 A G 6: 87,819,592 F239L possibly damaging Het
Itgb5 A G 16: 33,865,547 T86A probably benign Het
Itpr1 T C 6: 108,405,520 C1458R possibly damaging Het
Krt28 T C 11: 99,365,095 E446G probably damaging Het
Lama1 A T 17: 67,822,409 Q3071L Het
Lasp1 A G 11: 97,806,767 probably benign Het
Lmf2 T C 15: 89,353,216 K348E probably benign Het
Lrch3 G T 16: 32,975,738 E331* probably null Het
Lzic T A 4: 149,488,684 F98I probably damaging Het
Map7d1 C A 4: 126,233,647 probably null Het
March8 C T 6: 116,401,444 T113I possibly damaging Het
Mgrn1 A T 16: 4,927,876 K423* probably null Het
Muc20 G A 16: 32,794,896 T37I possibly damaging Het
Myh15 A G 16: 49,138,681 E972G probably damaging Het
Myocd T A 11: 65,196,341 K253N probably damaging Het
Myod1 T G 7: 46,377,151 L160R probably damaging Het
Nanog T C 6: 122,707,840 S20P probably benign Het
Nat8f2 A T 6: 85,867,701 Y226* probably null Het
Nsmf A G 2: 25,059,065 K277R probably null Het
Nsrp1 C T 11: 77,076,677 G30R probably damaging Het
Nsun6 C A 2: 14,998,198 R389L probably benign Het
Obscn G A 11: 59,052,571 R4251C probably benign Het
Olfr1153 G A 2: 87,896,558 D120N probably damaging Het
Olfr555 A G 7: 102,659,234 T138A probably damaging Het
Olfr749 C T 14: 50,736,742 C140Y probably benign Het
Olfr979 A T 9: 40,000,876 M117K probably damaging Het
Pgm2 T C 4: 99,986,721 L567P probably damaging Het
Polrmt G T 10: 79,740,701 H474N probably benign Het
Ppfia2 A G 10: 106,829,024 I374V probably benign Het
Pramel5 T A 4: 144,272,975 I181F probably benign Het
Prpf4b T A 13: 34,899,887 Y880N probably damaging Het
Ptpn3 G A 4: 57,249,957 Q180* probably null Het
Ptprc T C 1: 138,080,889 R687G probably damaging Het
Rnaseh2a T C 8: 84,958,009 T241A probably damaging Het
Rnf148 T A 6: 23,654,803 I65F possibly damaging Het
Rnf213 A G 11: 119,441,005 I2348V Het
Rttn A G 18: 89,017,210 N736S possibly damaging Het
Ryr3 A C 2: 112,803,189 V2093G probably damaging Het
Selenof T A 3: 144,577,609 F33L probably benign Het
Sh2d3c C T 2: 32,745,877 R238* probably null Het
Slc23a4 T C 6: 34,946,300 K543R probably benign Het
Smn1 A T 13: 100,135,702 N278I possibly damaging Het
Sox7 G A 14: 63,948,060 A182T probably benign Het
Sptlc2 A T 12: 87,312,759 I501N probably benign Het
Srf T C 17: 46,555,345 T162A probably benign Het
Srm C T 4: 148,591,582 probably benign Het
Stim1 CAGCGCCTGACGGAGC CAGC 7: 102,430,911 probably benign Het
Taar8a T C 10: 24,076,816 L106P probably damaging Het
Tcte1 A G 17: 45,539,872 H358R possibly damaging Het
Tmem205 A G 9: 21,926,291 S20P probably damaging Het
Trav16 T A 14: 53,743,453 V33E possibly damaging Het
Trf T A 9: 103,226,018 I149F probably damaging Het
Trmt2a C T 16: 18,252,177 Q419* probably null Het
Ttc19 A G 11: 62,313,171 I319M probably benign Het
Txndc16 T C 14: 45,163,010 I345V probably benign Het
Ubr3 T C 2: 69,897,613 F107L possibly damaging Het
Vmn1r73 T C 7: 11,756,480 F75S possibly damaging Het
Vmn2r54 A T 7: 12,629,826 M380K possibly damaging Het
Wdr7 T A 18: 63,794,246 M989K possibly damaging Het
Zcchc3 A G 2: 152,414,465 S105P probably benign Het
Zfp735 T A 11: 73,710,980 V250E possibly damaging Het
Other mutations in Ube3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ube3b APN 5 114415287 missense possibly damaging 0.93
IGL01154:Ube3b APN 5 114406252 missense probably null 0.86
IGL02632:Ube3b APN 5 114398841 missense probably benign
IGL02850:Ube3b APN 5 114406249 missense probably damaging 1.00
IGL02878:Ube3b APN 5 114404717 splice site probably null
IGL02881:Ube3b APN 5 114412884 missense possibly damaging 0.78
R0003:Ube3b UTSW 5 114398851 missense probably benign 0.17
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0071:Ube3b UTSW 5 114419497 missense probably damaging 1.00
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0076:Ube3b UTSW 5 114408217 critical splice donor site probably null
R0111:Ube3b UTSW 5 114390376 splice site probably benign
R0309:Ube3b UTSW 5 114419469 splice site probably benign
R0718:Ube3b UTSW 5 114402555 nonsense probably null
R1344:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1350:Ube3b UTSW 5 114406137 splice site probably null
R1418:Ube3b UTSW 5 114418575 missense probably damaging 1.00
R1732:Ube3b UTSW 5 114387445 missense probably benign 0.01
R1764:Ube3b UTSW 5 114404617 missense possibly damaging 0.89
R1975:Ube3b UTSW 5 114399865 missense possibly damaging 0.80
R2014:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2015:Ube3b UTSW 5 114411149 missense probably damaging 1.00
R2041:Ube3b UTSW 5 114387233 missense probably damaging 0.99
R2074:Ube3b UTSW 5 114415255 missense probably benign 0.14
R2202:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R2205:Ube3b UTSW 5 114389074 missense probably damaging 1.00
R3826:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3829:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3830:Ube3b UTSW 5 114399951 missense probably damaging 0.99
R3927:Ube3b UTSW 5 114415680 missense probably benign 0.03
R3974:Ube3b UTSW 5 114412430 missense probably benign 0.05
R4049:Ube3b UTSW 5 114412870 missense probably benign 0.09
R4096:Ube3b UTSW 5 114393086 missense possibly damaging 0.65
R4261:Ube3b UTSW 5 114398428 missense possibly damaging 0.80
R4415:Ube3b UTSW 5 114412444 missense probably damaging 1.00
R4688:Ube3b UTSW 5 114393078 missense probably benign 0.03
R4779:Ube3b UTSW 5 114404717 splice site probably null
R4824:Ube3b UTSW 5 114415726 splice site probably null
R4868:Ube3b UTSW 5 114398427 missense probably benign 0.00
R4953:Ube3b UTSW 5 114401410 missense probably benign 0.01
R5013:Ube3b UTSW 5 114407641 missense probably damaging 1.00
R5057:Ube3b UTSW 5 114406257 missense probably benign 0.01
R5117:Ube3b UTSW 5 114419631 missense probably damaging 0.96
R5131:Ube3b UTSW 5 114407546 missense probably damaging 1.00
R5498:Ube3b UTSW 5 114418574 missense probably damaging 1.00
R5564:Ube3b UTSW 5 114389075 missense probably damaging 1.00
R5572:Ube3b UTSW 5 114406179 missense probably damaging 0.99
R5580:Ube3b UTSW 5 114415323 missense probably benign
R5596:Ube3b UTSW 5 114406160 splice site probably null
R5843:Ube3b UTSW 5 114412299 missense probably damaging 1.00
R5910:Ube3b UTSW 5 114415309 missense possibly damaging 0.63
R6591:Ube3b UTSW 5 114408124 missense probably benign 0.00
R6691:Ube3b UTSW 5 114408124 missense probably benign 0.00
R7148:Ube3b UTSW 5 114406252 missense probably damaging 0.97
R7334:Ube3b UTSW 5 114415681 missense possibly damaging 0.64
R7438:Ube3b UTSW 5 114415284 missense possibly damaging 0.79
R7438:Ube3b UTSW 5 114418626 missense probably damaging 1.00
R7640:Ube3b UTSW 5 114415323 missense probably benign
R7825:Ube3b UTSW 5 114401312 missense probably damaging 1.00
R7958:Ube3b UTSW 5 114401423 missense probably benign 0.05
R8025:Ube3b UTSW 5 114408209 missense probably damaging 0.99
R8058:Ube3b UTSW 5 114406785 missense possibly damaging 0.58
R8087:Ube3b UTSW 5 114412489 critical splice donor site probably null
R8182:Ube3b UTSW 5 114392138 missense possibly damaging 0.77
R8322:Ube3b UTSW 5 114402686 missense probably benign 0.04
R8465:Ube3b UTSW 5 114390390 missense probably damaging 1.00
R8682:Ube3b UTSW 5 114412290 missense probably damaging 1.00
R8708:Ube3b UTSW 5 114393090 missense probably benign 0.34
R8758:Ube3b UTSW 5 114415200 critical splice acceptor site probably benign
R8784:Ube3b UTSW 5 114388739 missense probably damaging 1.00
R9058:Ube3b UTSW 5 114415239 missense probably benign 0.05
R9072:Ube3b UTSW 5 114404546 missense probably damaging 0.98
R9116:Ube3b UTSW 5 114404776 intron probably benign
R9537:Ube3b UTSW 5 114387184 missense probably damaging 1.00
R9596:Ube3b UTSW 5 114389110 missense probably damaging 1.00
R9632:Ube3b UTSW 5 114415309 missense probably benign 0.00
X0017:Ube3b UTSW 5 114415585 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- CTCTTAGCATGCTTGGCAGC -3'
(R):5'- GAAACTAAATGGGCTGTCATCAG -3'

Sequencing Primer
(F):5'- CCTAGCCAGCTCATCCCAGTG -3'
(R):5'- GGATACCAGAGTCACTCTATGTCAG -3'
Posted On 2022-10-06