Mutagenetix > Incidental Mutation

Incidental Mutation 'R9710:Itpr1'

730061

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Essential gene?

Probably essential (E-score: 0.797) question?

Stock #

R9710 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108405520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 1458 (C1458R)

Ref Sequence

ENSEMBL: ENSMUSP00000032192 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]

AlphaFold

no structure available at present

PDB Structure

Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032192
AA Change: C1458R

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: C1458R

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203615
AA Change: C1458R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: C1458R

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000212125

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 92 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930407I10Rik	T	C	15: 82,062,651	S250P	probably benign	Het
A430105I19Rik	G	T	2: 118,760,596	A152E	probably benign	Het
Ahcyl1	T	A	3: 107,671,178	I248F	possibly damaging	Het
Alpk2	T	A	18: 65,349,575	E454V	probably damaging	Het
Ank3	A	T	10: 69,993,240	T2580S		Het
Anks1	G	A	17: 27,909,597	G46R	possibly damaging	Het
Arhgap45	A	G	10: 80,021,801	E322G	probably damaging	Het
Arhgef2	T	C	3: 88,621,269	I4T	probably benign	Het
C1qtnf4	T	C	2: 90,890,007	I208T	probably damaging	Het
Cachd1	T	A	4: 100,974,895	N751K	probably benign	Het
Cacna1a	G	T	8: 84,594,179	V1589F	possibly damaging	Het
Cacnb1	T	C	11: 98,011,371	H205R	probably benign	Het
Clvs2	C	A	10: 33,513,311	R311L	probably benign	Het
Crim1	G	T	17: 78,303,075	G320*	probably null	Het
Crtam	A	T	9: 40,984,375	D218E	probably benign	Het
Cwc27	G	A	13: 104,806,650	T128I	probably damaging	Het
Cyp4a14	T	A	4: 115,492,150	I238F	probably benign	Het
D930020B18Rik	A	C	10: 121,667,658	E246A	probably benign	Het
Dsg1c	T	A	18: 20,276,987	V504E	probably benign	Het
Enpp6	T	A	8: 47,065,913	S239T	probably damaging	Het
Eri2	A	T	7: 119,785,601	I559N	probably benign	Het
Fbxo34	T	C	14: 47,531,267	Y746H	probably damaging	Het
Galr1	A	T	18: 82,405,978	L58Q	probably damaging	Het
Gatsl3	A	G	11: 4,219,015	K61E	probably benign	Het
Ghdc	A	G	11: 100,768,037	V423A	probably benign	Het
Glt28d2	T	C	3: 85,871,752	D138G	probably benign	Het
Gm266	A	T	12: 111,485,329	C148S	probably benign	Het
Gm597	T	A	1: 28,778,039	Y304F	probably benign	Het
Gnas	C	T	2: 174,299,339	T493M	unknown	Het
Hivep2	T	C	10: 14,139,459	I1790T	probably damaging	Het
Impg1	A	G	9: 80,379,994	V390A	probably benign	Het
Isy1	A	G	6: 87,819,592	F239L	possibly damaging	Het
Itgb5	A	G	16: 33,865,547	T86A	probably benign	Het
Krt28	T	C	11: 99,365,095	E446G	probably damaging	Het
Lama1	A	T	17: 67,822,409	Q3071L		Het
Lasp1	A	G	11: 97,806,767		probably benign	Het
Lmf2	T	C	15: 89,353,216	K348E	probably benign	Het
Lrch3	G	T	16: 32,975,738	E331*	probably null	Het
Lzic	T	A	4: 149,488,684	F98I	probably damaging	Het
Map7d1	C	A	4: 126,233,647		probably null	Het
March8	C	T	6: 116,401,444	T113I	possibly damaging	Het
Mgrn1	A	T	16: 4,927,876	K423*	probably null	Het
Muc20	G	A	16: 32,794,896	T37I	possibly damaging	Het
Myh15	A	G	16: 49,138,681	E972G	probably damaging	Het
Myocd	T	A	11: 65,196,341	K253N	probably damaging	Het
Myod1	T	G	7: 46,377,151	L160R	probably damaging	Het
Nanog	T	C	6: 122,707,840	S20P	probably benign	Het
Nat8f2	A	T	6: 85,867,701	Y226*	probably null	Het
Nsmf	A	G	2: 25,059,065	K277R	probably null	Het
Nsrp1	C	T	11: 77,076,677	G30R	probably damaging	Het
Nsun6	C	A	2: 14,998,198	R389L	probably benign	Het
Obscn	G	A	11: 59,052,571	R4251C	probably benign	Het
Olfr1153	G	A	2: 87,896,558	D120N	probably damaging	Het
Olfr555	A	G	7: 102,659,234	T138A	probably damaging	Het
Olfr749	C	T	14: 50,736,742	C140Y	probably benign	Het
Olfr979	A	T	9: 40,000,876	M117K	probably damaging	Het
Pgm2	T	C	4: 99,986,721	L567P	probably damaging	Het
Polrmt	G	T	10: 79,740,701	H474N	probably benign	Het
Ppfia2	A	G	10: 106,829,024	I374V	probably benign	Het
Pramel5	T	A	4: 144,272,975	I181F	probably benign	Het
Prpf4b	T	A	13: 34,899,887	Y880N	probably damaging	Het
Ptpn3	G	A	4: 57,249,957	Q180*	probably null	Het
Ptprc	T	C	1: 138,080,889	R687G	probably damaging	Het
Rnaseh2a	T	C	8: 84,958,009	T241A	probably damaging	Het
Rnf148	T	A	6: 23,654,803	I65F	possibly damaging	Het
Rnf213	A	G	11: 119,441,005	I2348V		Het
Rttn	A	G	18: 89,017,210	N736S	possibly damaging	Het
Ryr3	A	C	2: 112,803,189	V2093G	probably damaging	Het
Selenof	T	A	3: 144,577,609	F33L	probably benign	Het
Sh2d3c	C	T	2: 32,745,877	R238*	probably null	Het
Slc23a4	T	C	6: 34,946,300	K543R	probably benign	Het
Smn1	A	T	13: 100,135,702	N278I	possibly damaging	Het
Sox7	G	A	14: 63,948,060	A182T	probably benign	Het
Sptlc2	A	T	12: 87,312,759	I501N	probably benign	Het
Srf	T	C	17: 46,555,345	T162A	probably benign	Het
Srm	C	T	4: 148,591,582		probably benign	Het
Stim1	CAGCGCCTGACGGAGC	CAGC	7: 102,430,911		probably benign	Het
Taar8a	T	C	10: 24,076,816	L106P	probably damaging	Het
Tcte1	A	G	17: 45,539,872	H358R	possibly damaging	Het
Tmem205	A	G	9: 21,926,291	S20P	probably damaging	Het
Trav16	T	A	14: 53,743,453	V33E	possibly damaging	Het
Trf	T	A	9: 103,226,018	I149F	probably damaging	Het
Trmt2a	C	T	16: 18,252,177	Q419*	probably null	Het
Ttc19	A	G	11: 62,313,171	I319M	probably benign	Het
Txndc16	T	C	14: 45,163,010	I345V	probably benign	Het
Ube3b	T	C	5: 114,415,309	I914T	probably benign	Het
Ubr3	T	C	2: 69,897,613	F107L	possibly damaging	Het
Vmn1r73	T	C	7: 11,756,480	F75S	possibly damaging	Het
Vmn2r54	A	T	7: 12,629,826	M380K	possibly damaging	Het
Wdr7	T	A	18: 63,794,246	M989K	possibly damaging	Het
Zcchc3	A	G	2: 152,414,465	S105P	probably benign	Het
Zfp735	T	A	11: 73,710,980	V250E	possibly damaging	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
marsupialized	UTSW	6	108394073	splice site	probably null
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7014:Itpr1	UTSW	6	108431498	critical splice donor site	probably null
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8697:Itpr1	UTSW	6	108523366	missense	probably damaging	1.00
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
R8870:Itpr1	UTSW	6	108388211	missense	probably damaging	1.00
R8921:Itpr1	UTSW	6	108378198	missense	possibly damaging	0.87
R8961:Itpr1	UTSW	6	108493705	missense	possibly damaging	0.86
R9095:Itpr1	UTSW	6	108387391	missense	probably benign	0.02
R9205:Itpr1	UTSW	6	108489849	missense	probably damaging	0.99
R9282:Itpr1	UTSW	6	108394023	missense	probably damaging	1.00
R9323:Itpr1	UTSW	6	108352018	missense	probably damaging	1.00
R9376:Itpr1	UTSW	6	108349677	missense	probably damaging	0.99
R9392:Itpr1	UTSW	6	108413876	missense	probably benign
R9428:Itpr1	UTSW	6	108401347	missense	possibly damaging	0.84
R9621:Itpr1	UTSW	6	108416909	missense	probably damaging	1.00
R9632:Itpr1	UTSW	6	108405520	missense	possibly damaging	0.50
R9646:Itpr1	UTSW	6	108394884	missense	probably damaging	1.00
R9695:Itpr1	UTSW	6	108401350	missense	probably damaging	1.00
R9721:Itpr1	UTSW	6	108406102	missense	probably damaging	0.96
R9780:Itpr1	UTSW	6	108510834	missense	probably benign	0.03
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATGGGCTCCTTGTGGAAG -3'
(R):5'- GTTCTGCTTGGAATAAGATTAGCC -3'

Sequencing Primer
(F):5'- GCGGGGTTGTCACAAGAGC -3'
(R):5'- CTGCTTGGAATAAGATTAGCCCTTTC -3'

Posted On

2022-10-06