Incidental Mutation 'R9710:Itpr1'
ID 730061
Institutional Source Beutler Lab
Gene Symbol Itpr1
Ensembl Gene ENSMUSG00000030102
Gene Name inositol 1,4,5-trisphosphate receptor 1
Synonyms opt, IP3R1, P400, wblo, Ip3r, Pcp-1, Itpr-1, InsP3R type I, Pcp1
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.736) question?
Stock # R9710 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 108190057-108528070 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108382481 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 1458 (C1458R)
Ref Sequence ENSEMBL: ENSMUSP00000032192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203615] [ENSMUST00000212125]
AlphaFold no structure available at present
PDB Structure Crystal structure of the inositol 1,4,5-trisphosphate receptor binding core in complex with IP3 [X-RAY DIFFRACTION]
Crystal structure of the ligand binding suppressor domain of type 1 inositol 1,4,5-trisphosphate receptor [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032192
AA Change: C1458R

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102
AA Change: C1458R

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1758 1787 N/A INTRINSIC
Pfam:RIH_assoc 1959 2069 1.2e-33 PFAM
transmembrane domain 2274 2296 N/A INTRINSIC
Pfam:Ion_trans 2311 2600 9e-22 PFAM
coiled coil region 2683 2732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203615
AA Change: C1458R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102
AA Change: C1458R

DomainStartEndE-ValueType
MIR 112 166 7.99e-8 SMART
MIR 173 223 1.02e-5 SMART
MIR 231 287 2.33e-9 SMART
MIR 294 403 5.95e-16 SMART
Pfam:RYDR_ITPR 474 670 2.3e-61 PFAM
low complexity region 683 695 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1020 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1344 1.9e-14 PFAM
low complexity region 1757 1786 N/A INTRINSIC
Pfam:RIH_assoc 1958 2068 1.2e-33 PFAM
transmembrane domain 2273 2295 N/A INTRINSIC
Pfam:Ion_trans 2310 2599 9e-22 PFAM
coiled coil region 2682 2731 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000212125
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]
Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik T C 15: 81,946,852 (GRCm39) S250P probably benign Het
Ahcyl1 T A 3: 107,578,494 (GRCm39) I248F possibly damaging Het
Alpk2 T A 18: 65,482,646 (GRCm39) E454V probably damaging Het
Ank3 A T 10: 69,829,070 (GRCm39) T2580S Het
Anks1 G A 17: 28,128,571 (GRCm39) G46R possibly damaging Het
Arhgap45 A G 10: 79,857,635 (GRCm39) E322G probably damaging Het
Arhgef2 T C 3: 88,528,576 (GRCm39) I4T probably benign Het
C1qtnf4 T C 2: 90,720,351 (GRCm39) I208T probably damaging Het
Cachd1 T A 4: 100,832,092 (GRCm39) N751K probably benign Het
Cacna1a G T 8: 85,320,808 (GRCm39) V1589F possibly damaging Het
Cacnb1 T C 11: 97,902,197 (GRCm39) H205R probably benign Het
Castor1 A G 11: 4,169,015 (GRCm39) K61E probably benign Het
Ccdc9b G T 2: 118,591,077 (GRCm39) A152E probably benign Het
Clvs2 C A 10: 33,389,307 (GRCm39) R311L probably benign Het
Crim1 G T 17: 78,610,504 (GRCm39) G320* probably null Het
Crtam A T 9: 40,895,671 (GRCm39) D218E probably benign Het
Cwc27 G A 13: 104,943,158 (GRCm39) T128I probably damaging Het
Cyp4a14 T A 4: 115,349,347 (GRCm39) I238F probably benign Het
D930020B18Rik A C 10: 121,503,563 (GRCm39) E246A probably benign Het
Dsg1c T A 18: 20,410,044 (GRCm39) V504E probably benign Het
Enpp6 T A 8: 47,518,948 (GRCm39) S239T probably damaging Het
Eri2 A T 7: 119,384,824 (GRCm39) I559N probably benign Het
Fbxo34 T C 14: 47,768,724 (GRCm39) Y746H probably damaging Het
Galr1 A T 18: 82,424,103 (GRCm39) L58Q probably damaging Het
Ghdc A G 11: 100,658,863 (GRCm39) V423A probably benign Het
Glt28d2 T C 3: 85,779,059 (GRCm39) D138G probably benign Het
Gm266 A T 12: 111,451,763 (GRCm39) C148S probably benign Het
Gnas C T 2: 174,141,132 (GRCm39) T493M unknown Het
Hivep2 T C 10: 14,015,203 (GRCm39) I1790T probably damaging Het
Impg1 A G 9: 80,287,276 (GRCm39) V390A probably benign Het
Isy1 A G 6: 87,796,574 (GRCm39) F239L possibly damaging Het
Itgb5 A G 16: 33,685,917 (GRCm39) T86A probably benign Het
Krt28 T C 11: 99,255,921 (GRCm39) E446G probably damaging Het
Lama1 A T 17: 68,129,404 (GRCm39) Q3071L Het
Lasp1 A G 11: 97,697,593 (GRCm39) probably benign Het
Lmf2 T C 15: 89,237,419 (GRCm39) K348E probably benign Het
Lrch3 G T 16: 32,796,108 (GRCm39) E331* probably null Het
Lzic T A 4: 149,573,141 (GRCm39) F98I probably damaging Het
Map7d1 C A 4: 126,127,440 (GRCm39) probably null Het
Marchf8 C T 6: 116,378,405 (GRCm39) T113I possibly damaging Het
Mgrn1 A T 16: 4,745,740 (GRCm39) K423* probably null Het
Muc20 G A 16: 32,615,266 (GRCm39) T37I possibly damaging Het
Myh15 A G 16: 48,959,044 (GRCm39) E972G probably damaging Het
Myocd T A 11: 65,087,167 (GRCm39) K253N probably damaging Het
Myod1 T G 7: 46,026,575 (GRCm39) L160R probably damaging Het
Nanog T C 6: 122,684,799 (GRCm39) S20P probably benign Het
Nat8f2 A T 6: 85,844,683 (GRCm39) Y226* probably null Het
Nsmf A G 2: 24,949,077 (GRCm39) K277R probably null Het
Nsrp1 C T 11: 76,967,503 (GRCm39) G30R probably damaging Het
Nsun6 C A 2: 15,003,009 (GRCm39) R389L probably benign Het
Obscn G A 11: 58,943,397 (GRCm39) R4251C probably benign Het
Or10g9 A T 9: 39,912,172 (GRCm39) M117K probably damaging Het
Or11h4 C T 14: 50,974,199 (GRCm39) C140Y probably benign Het
Or51h1 A G 7: 102,308,441 (GRCm39) T138A probably damaging Het
Or5w20 G A 2: 87,726,902 (GRCm39) D120N probably damaging Het
Pgm1 T C 4: 99,843,918 (GRCm39) L567P probably damaging Het
Polrmt G T 10: 79,576,535 (GRCm39) H474N probably benign Het
Ppfia2 A G 10: 106,664,885 (GRCm39) I374V probably benign Het
Pramel5 T A 4: 143,999,545 (GRCm39) I181F probably benign Het
Prpf4b T A 13: 35,083,870 (GRCm39) Y880N probably damaging Het
Ptpn3 G A 4: 57,249,957 (GRCm39) Q180* probably null Het
Ptprc T C 1: 138,008,627 (GRCm39) R687G probably damaging Het
Rnaseh2a T C 8: 85,684,638 (GRCm39) T241A probably damaging Het
Rnf148 T A 6: 23,654,802 (GRCm39) I65F possibly damaging Het
Rnf213 A G 11: 119,331,831 (GRCm39) I2348V Het
Rttn A G 18: 89,035,334 (GRCm39) N736S possibly damaging Het
Ryr3 A C 2: 112,633,534 (GRCm39) V2093G probably damaging Het
Selenof T A 3: 144,283,370 (GRCm39) F33L probably benign Het
Sh2d3c C T 2: 32,635,889 (GRCm39) R238* probably null Het
Slc23a4 T C 6: 34,923,235 (GRCm39) K543R probably benign Het
Smn1 A T 13: 100,272,210 (GRCm39) N278I possibly damaging Het
Sox7 G A 14: 64,185,509 (GRCm39) A182T probably benign Het
Spata31e5 T A 1: 28,817,120 (GRCm39) Y304F probably benign Het
Sptlc2 A T 12: 87,359,533 (GRCm39) I501N probably benign Het
Srf T C 17: 46,866,271 (GRCm39) T162A probably benign Het
Srm C T 4: 148,676,039 (GRCm39) probably benign Het
Stim1 CAGCGCCTGACGGAGC CAGC 7: 102,080,118 (GRCm39) probably benign Het
Taar8a T C 10: 23,952,714 (GRCm39) L106P probably damaging Het
Tcte1 A G 17: 45,850,798 (GRCm39) H358R possibly damaging Het
Tmem205 A G 9: 21,837,587 (GRCm39) S20P probably damaging Het
Trav16 T A 14: 53,980,910 (GRCm39) V33E possibly damaging Het
Trf T A 9: 103,103,217 (GRCm39) I149F probably damaging Het
Trmt2a C T 16: 18,070,041 (GRCm39) Q419* probably null Het
Ttc19 A G 11: 62,203,997 (GRCm39) I319M probably benign Het
Txndc16 T C 14: 45,400,467 (GRCm39) I345V probably benign Het
Ube3b T C 5: 114,553,370 (GRCm39) I914T probably benign Het
Ubr3 T C 2: 69,727,957 (GRCm39) F107L possibly damaging Het
Vmn1r73 T C 7: 11,490,407 (GRCm39) F75S possibly damaging Het
Vmn2r54 A T 7: 12,363,753 (GRCm39) M380K possibly damaging Het
Wdr7 T A 18: 63,927,317 (GRCm39) M989K possibly damaging Het
Zcchc3 A G 2: 152,256,385 (GRCm39) S105P probably benign Het
Zfp735 T A 11: 73,601,806 (GRCm39) V250E possibly damaging Het
Other mutations in Itpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Itpr1 APN 6 108,448,081 (GRCm39) missense probably damaging 0.98
IGL01073:Itpr1 APN 6 108,390,781 (GRCm39) missense probably benign 0.00
IGL01105:Itpr1 APN 6 108,358,294 (GRCm39) missense probably benign 0.00
IGL01296:Itpr1 APN 6 108,376,322 (GRCm39) missense probably damaging 1.00
IGL01325:Itpr1 APN 6 108,358,169 (GRCm39) missense probably benign 0.01
IGL01418:Itpr1 APN 6 108,316,585 (GRCm39) critical splice donor site probably null
IGL01464:Itpr1 APN 6 108,363,688 (GRCm39) missense possibly damaging 0.95
IGL01467:Itpr1 APN 6 108,465,457 (GRCm39) missense probably damaging 0.96
IGL01645:Itpr1 APN 6 108,450,560 (GRCm39) missense possibly damaging 0.91
IGL01672:Itpr1 APN 6 108,357,993 (GRCm39) nonsense probably null
IGL01969:Itpr1 APN 6 108,354,652 (GRCm39) missense probably damaging 1.00
IGL02164:Itpr1 APN 6 108,366,444 (GRCm39) missense probably benign 0.08
IGL02206:Itpr1 APN 6 108,526,781 (GRCm39) missense probably damaging 1.00
IGL02232:Itpr1 APN 6 108,394,884 (GRCm39) missense probably damaging 1.00
IGL02297:Itpr1 APN 6 108,316,478 (GRCm39) missense possibly damaging 0.84
IGL02434:Itpr1 APN 6 108,466,883 (GRCm39) splice site probably null
IGL02568:Itpr1 APN 6 108,316,515 (GRCm39) missense possibly damaging 0.82
IGL02992:Itpr1 APN 6 108,358,276 (GRCm39) missense probably damaging 1.00
IGL03109:Itpr1 APN 6 108,394,942 (GRCm39) missense probably damaging 1.00
IGL03130:Itpr1 APN 6 108,500,362 (GRCm39) missense probably benign 0.00
IGL03333:Itpr1 APN 6 108,357,871 (GRCm39) unclassified probably benign
aboriginal UTSW 6 108,492,908 (GRCm39) missense probably benign
approximation UTSW 6 108,371,802 (GRCm39) missense probably benign
estimate UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
icarus UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
marsupialized UTSW 6 108,371,034 (GRCm39) splice site probably null
primordial UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
roo UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
wallaby UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
P0005:Itpr1 UTSW 6 108,358,218 (GRCm39) missense probably damaging 1.00
PIT4366001:Itpr1 UTSW 6 108,470,718 (GRCm39) nonsense probably null
R0019:Itpr1 UTSW 6 108,331,587 (GRCm39) missense probably damaging 1.00
R0128:Itpr1 UTSW 6 108,448,170 (GRCm39) splice site probably benign
R0129:Itpr1 UTSW 6 108,326,637 (GRCm39) missense probably damaging 1.00
R0135:Itpr1 UTSW 6 108,465,443 (GRCm39) splice site probably benign
R0244:Itpr1 UTSW 6 108,450,550 (GRCm39) missense probably benign 0.00
R0391:Itpr1 UTSW 6 108,355,128 (GRCm39) missense probably benign 0.22
R0543:Itpr1 UTSW 6 108,492,709 (GRCm39) splice site probably benign
R0647:Itpr1 UTSW 6 108,360,659 (GRCm39) missense probably damaging 1.00
R0766:Itpr1 UTSW 6 108,387,861 (GRCm39) missense probably damaging 1.00
R0971:Itpr1 UTSW 6 108,326,590 (GRCm39) missense possibly damaging 0.70
R1083:Itpr1 UTSW 6 108,487,657 (GRCm39) missense possibly damaging 0.92
R1277:Itpr1 UTSW 6 108,316,582 (GRCm39) missense probably benign 0.22
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1403:Itpr1 UTSW 6 108,366,514 (GRCm39) missense probably null 1.00
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1404:Itpr1 UTSW 6 108,363,609 (GRCm39) missense probably benign 0.04
R1605:Itpr1 UTSW 6 108,326,620 (GRCm39) missense possibly damaging 0.77
R1661:Itpr1 UTSW 6 108,459,858 (GRCm39) missense probably benign 0.38
R1852:Itpr1 UTSW 6 108,363,667 (GRCm39) missense probably damaging 1.00
R1929:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2012:Itpr1 UTSW 6 108,417,497 (GRCm39) missense probably benign 0.02
R2027:Itpr1 UTSW 6 108,363,814 (GRCm39) missense possibly damaging 0.80
R2111:Itpr1 UTSW 6 108,355,270 (GRCm39) unclassified probably benign
R2166:Itpr1 UTSW 6 108,365,186 (GRCm39) missense probably damaging 1.00
R2272:Itpr1 UTSW 6 108,470,716 (GRCm39) missense probably damaging 1.00
R2484:Itpr1 UTSW 6 108,346,071 (GRCm39) missense probably damaging 1.00
R3115:Itpr1 UTSW 6 108,383,070 (GRCm39) missense possibly damaging 0.55
R3751:Itpr1 UTSW 6 108,326,641 (GRCm39) missense probably damaging 1.00
R3798:Itpr1 UTSW 6 108,358,231 (GRCm39) missense probably damaging 1.00
R3930:Itpr1 UTSW 6 108,371,802 (GRCm39) missense probably benign
R4081:Itpr1 UTSW 6 108,368,796 (GRCm39) missense probably damaging 1.00
R4119:Itpr1 UTSW 6 108,371,316 (GRCm39) missense probably benign
R4406:Itpr1 UTSW 6 108,331,624 (GRCm39) missense probably damaging 1.00
R4506:Itpr1 UTSW 6 108,409,647 (GRCm39) missense probably damaging 1.00
R4616:Itpr1 UTSW 6 108,458,184 (GRCm39) missense probably damaging 1.00
R4655:Itpr1 UTSW 6 108,458,254 (GRCm39) missense probably damaging 1.00
R4661:Itpr1 UTSW 6 108,387,892 (GRCm39) critical splice donor site probably null
R4760:Itpr1 UTSW 6 108,326,593 (GRCm39) missense probably benign 0.29
R4836:Itpr1 UTSW 6 108,366,498 (GRCm39) missense probably damaging 0.99
R4857:Itpr1 UTSW 6 108,387,828 (GRCm39) missense probably benign 0.00
R4876:Itpr1 UTSW 6 108,459,867 (GRCm39) missense probably damaging 0.97
R4939:Itpr1 UTSW 6 108,417,519 (GRCm39) nonsense probably null
R5076:Itpr1 UTSW 6 108,382,490 (GRCm39) splice site probably null
R5088:Itpr1 UTSW 6 108,366,348 (GRCm39) missense probably damaging 1.00
R5248:Itpr1 UTSW 6 108,519,023 (GRCm39) missense probably damaging 1.00
R5290:Itpr1 UTSW 6 108,383,106 (GRCm39) missense possibly damaging 0.95
R5308:Itpr1 UTSW 6 108,333,472 (GRCm39) missense probably damaging 1.00
R5339:Itpr1 UTSW 6 108,370,922 (GRCm39) missense probably damaging 1.00
R5368:Itpr1 UTSW 6 108,364,459 (GRCm39) missense probably damaging 1.00
R5369:Itpr1 UTSW 6 108,496,385 (GRCm39) missense probably damaging 0.99
R5419:Itpr1 UTSW 6 108,470,755 (GRCm39) missense possibly damaging 0.95
R5615:Itpr1 UTSW 6 108,465,561 (GRCm39) missense possibly damaging 0.71
R5779:Itpr1 UTSW 6 108,329,104 (GRCm39) missense probably damaging 1.00
R5781:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.23
R5869:Itpr1 UTSW 6 108,450,490 (GRCm39) missense probably benign 0.30
R5903:Itpr1 UTSW 6 108,466,758 (GRCm39) intron probably benign
R5929:Itpr1 UTSW 6 108,400,297 (GRCm39) missense probably benign
R5956:Itpr1 UTSW 6 108,482,988 (GRCm39) missense probably benign 0.25
R6160:Itpr1 UTSW 6 108,495,716 (GRCm39) missense probably benign 0.06
R6163:Itpr1 UTSW 6 108,365,245 (GRCm39) missense probably damaging 1.00
R6169:Itpr1 UTSW 6 108,346,077 (GRCm39) missense probably damaging 1.00
R6237:Itpr1 UTSW 6 108,355,164 (GRCm39) missense possibly damaging 0.53
R6398:Itpr1 UTSW 6 108,482,864 (GRCm39) missense probably damaging 0.96
R6455:Itpr1 UTSW 6 108,394,933 (GRCm39) missense probably damaging 1.00
R6522:Itpr1 UTSW 6 108,365,237 (GRCm39) missense probably damaging 1.00
R6524:Itpr1 UTSW 6 108,340,644 (GRCm39) missense probably damaging 1.00
R6650:Itpr1 UTSW 6 108,371,034 (GRCm39) splice site probably null
R6806:Itpr1 UTSW 6 108,492,908 (GRCm39) missense probably benign
R6838:Itpr1 UTSW 6 108,448,152 (GRCm39) missense possibly damaging 0.87
R6841:Itpr1 UTSW 6 108,365,153 (GRCm39) missense probably damaging 1.00
R6896:Itpr1 UTSW 6 108,458,355 (GRCm39) missense probably damaging 1.00
R7014:Itpr1 UTSW 6 108,408,459 (GRCm39) critical splice donor site probably null
R7076:Itpr1 UTSW 6 108,365,257 (GRCm39) missense probably benign
R7116:Itpr1 UTSW 6 108,458,229 (GRCm39) missense probably damaging 0.99
R7152:Itpr1 UTSW 6 108,371,368 (GRCm39) critical splice donor site probably null
R7161:Itpr1 UTSW 6 108,363,601 (GRCm39) missense probably damaging 1.00
R7166:Itpr1 UTSW 6 108,355,151 (GRCm39) missense probably benign 0.06
R7241:Itpr1 UTSW 6 108,494,581 (GRCm39) critical splice donor site probably null
R7301:Itpr1 UTSW 6 108,518,985 (GRCm39) missense possibly damaging 0.86
R7330:Itpr1 UTSW 6 108,415,292 (GRCm39) missense probably benign 0.28
R7449:Itpr1 UTSW 6 108,366,345 (GRCm39) missense probably damaging 0.98
R7472:Itpr1 UTSW 6 108,380,357 (GRCm39) missense probably benign 0.05
R7502:Itpr1 UTSW 6 108,360,639 (GRCm39) missense probably benign 0.00
R7779:Itpr1 UTSW 6 108,500,309 (GRCm39) missense possibly damaging 0.75
R7828:Itpr1 UTSW 6 108,459,892 (GRCm39) missense probably damaging 1.00
R7854:Itpr1 UTSW 6 108,364,330 (GRCm39) missense probably damaging 1.00
R7974:Itpr1 UTSW 6 108,500,366 (GRCm39) missense possibly damaging 0.86
R7998:Itpr1 UTSW 6 108,394,909 (GRCm39) missense possibly damaging 0.88
R8039:Itpr1 UTSW 6 108,363,589 (GRCm39) missense probably damaging 1.00
R8136:Itpr1 UTSW 6 108,415,321 (GRCm39) missense probably benign 0.18
R8200:Itpr1 UTSW 6 108,371,826 (GRCm39) missense probably benign 0.00
R8242:Itpr1 UTSW 6 108,363,658 (GRCm39) missense probably benign 0.44
R8322:Itpr1 UTSW 6 108,365,190 (GRCm39) missense probably benign 0.05
R8377:Itpr1 UTSW 6 108,487,699 (GRCm39) missense probably benign 0.00
R8412:Itpr1 UTSW 6 108,340,581 (GRCm39) missense probably benign 0.07
R8443:Itpr1 UTSW 6 108,496,309 (GRCm39) missense probably damaging 0.99
R8669:Itpr1 UTSW 6 108,370,928 (GRCm39) missense probably damaging 0.99
R8697:Itpr1 UTSW 6 108,500,327 (GRCm39) missense probably damaging 1.00
R8744:Itpr1 UTSW 6 108,354,763 (GRCm39) missense possibly damaging 0.79
R8870:Itpr1 UTSW 6 108,365,172 (GRCm39) missense probably damaging 1.00
R8921:Itpr1 UTSW 6 108,355,159 (GRCm39) missense possibly damaging 0.87
R8961:Itpr1 UTSW 6 108,470,666 (GRCm39) missense possibly damaging 0.86
R9095:Itpr1 UTSW 6 108,364,352 (GRCm39) missense probably benign 0.02
R9205:Itpr1 UTSW 6 108,466,810 (GRCm39) missense probably damaging 0.99
R9282:Itpr1 UTSW 6 108,370,984 (GRCm39) missense probably damaging 1.00
R9323:Itpr1 UTSW 6 108,328,979 (GRCm39) missense probably damaging 1.00
R9376:Itpr1 UTSW 6 108,326,638 (GRCm39) missense probably damaging 0.99
R9392:Itpr1 UTSW 6 108,390,837 (GRCm39) missense probably benign
R9428:Itpr1 UTSW 6 108,378,308 (GRCm39) missense possibly damaging 0.84
R9621:Itpr1 UTSW 6 108,393,870 (GRCm39) missense probably damaging 1.00
R9632:Itpr1 UTSW 6 108,382,481 (GRCm39) missense possibly damaging 0.50
R9646:Itpr1 UTSW 6 108,371,845 (GRCm39) missense probably damaging 1.00
R9695:Itpr1 UTSW 6 108,378,311 (GRCm39) missense probably damaging 1.00
R9721:Itpr1 UTSW 6 108,383,063 (GRCm39) missense probably damaging 0.96
R9780:Itpr1 UTSW 6 108,487,795 (GRCm39) missense probably benign 0.03
Z1176:Itpr1 UTSW 6 108,476,110 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATGGGCTCCTTGTGGAAG -3'
(R):5'- GTTCTGCTTGGAATAAGATTAGCC -3'

Sequencing Primer
(F):5'- GCGGGGTTGTCACAAGAGC -3'
(R):5'- CTGCTTGGAATAAGATTAGCCCTTTC -3'
Posted On 2022-10-06